Skip to main content

Table 4 Top 20 differentially expressed miRNAs between WT and MT

From: Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type

miRNA Sequence WT counta MT counta Fold change p-value
Higher expression in MT
csi-miR479 UGUGAUAUUGGUUCGGCUCAUC 1341.6 1921.5 1.9 0
csi-miR156a UGACAGAAGAGAGUGAGCAC 856.2 1656.1 2.6 0
csi-miR167a UGAAGCUGCCAGCAUGAUCUA 759.6 1967.3 21.6 0
csi-miR171b CGAGCCGAAUCAAUAUCACUC 28.5 615.4 4.5 0
csi-novel-08 UAGAUAAAGAUGAGAGAAAAA 220.1 1248.5 1.5 0
csi-miR166j UCUCGGACCAGGCUUCAUUCC 1682.9 2078.5 3.1 2.85E-22
Lower expression in MT
csi-miR482a UCUUCCCUAUGCCUCCCAUUCC 103.9 4.2 15.6 0
csi-miR162a UCGAUAAACCUCUGCAUCCAG 401.0 25.7 12.4 0
csi-miR159a UUUGGAUUGAAGGGAGCUCUA 307.8 24.8 3.5 0
csi-miR390a AAGCUCAGGAGGGAUAGCGCC 822.2 235.8 2.5 0
csi-miR164a UGGAGAAGCAGGGCACGUGCA 1894.0 749.0 1.6 0
csi-miR167d UGAAGCUGCCAGCAUGAUCUGA 1362.3 825.8 1.4 0
csi-miR172a AGAAUCUUGAUGAUGCUGCAU 4688.4 3299.7 1.4 0
csi-novel-11 UGGACAGAGAAAUCACGGUCA 591.5 132.7 5.7 0
csi-miR156b CUGACAGAAGACAGUGAGCAC 41.3 1.8 2.5 2.86E-27
csi-miR473a ACUCUCCCUCAAGGGCUUCGC 168.1 68.1 1.2 2.01E-26
csi-novel-03 UGAAGGGCCUUUCUAGAGCAC 90.5 29.6 8.1 2.87E-20
csi-miR399a UGCCAAAGGAGAAUUGCCCUG 36.3 4.5 13.8 3.14E-18
csi-miR482c UCUUGCCCACCCCUCCCAUUCC 29.0 2.1 15.6 8.98E-18
Csi-miR164d UGGAGAAGCAGGGCACGUGCU 49.1 11.1 4.4 7.6E-17
  1. a count was normalized as transcripts per million (TPM).