Skip to main content

Advertisement

Table 3 Probes and sequences used for the in situ hybridization experiments.

From: Microarray analysis of Shigella flexneri-infected epithelial cells identifies host factors important for apoptosis inhibition

Probe Sequence
JUN 5' - CCTGGGTTGAAGTTGCTGAGGTTTGCGTAGAC - 3'
TNFAIP3 5' - TGCGCTGGCTCGATCTCAGTTGCTCTTCTGTC - 3'
NFKBIA 5' - TCATGGATGATGGCCAAGTGCAGGAACGAGTC - 3'
CASP10 5' - TTGCCAGGACTCCTGCGGTAAGGCTTCCAAGA - 3'
NALP12 5' - GCCACAGCTATCCAGCCACAGTTTCTGGAGTC - 3'
ERCC2 5' - ATCTCTGGCACAGTTCTTGAGCAGTAGATGAG - 3'
DNAJA3 5' - GGTAATGTTTTGTTCCTGTGAGGCTGACACCA - 3'
CD38 5' - CGCTGGACCTGTGTGAACTGATGGGCCAGATC - 3'