Skip to main content

Table 3 Primers used for real-time quantitative PCR.

From: High gene expression of inflammatory markers and IL-17A correlates with severity of injection site reactions of Atlantic salmon vaccinated with oil-adjuvanted vaccines

Accession no. Name Direction Sequence T*A P** size (bp)
CB510337 T cell receptor alpha chain (TCAC) Fwd GCCTGGCTACAGATTTCAGC 66 107
   Rev GGCAACCTGGCTGTAGTAGC   
CA052383 Complement component C6 Fwd TCCAACGTGCCACTCTCCTC 64 131
   Rev CCGAACAGGGCTTCTACACC   
CA044561 L-plastin (Lymphocyte cytosolic protein 1) Fwd CATGCGAACACAGTCAGAACC 62 111
   Rev CAACGCCAAGTACGCTATCAC   
CA059313 Annexin A5 Fwd GAAACTTCAACGCCAACCAAG 60 115
   Rev TGTCTCTGGCTGTTGCTACG   
CA062753 SH2 domain protein 1A Fwd GGGAGTAGTCTCTGCTGTCC 62 95
   Rev GGCTCTACTGCCTCTGTGTG   
CB493440 Proteasome subunit alpha type 4 Fwd GTTCTAACCAATGAGCTGAGG 60 89
   Rev AACGCTGTCACCAACTGCTC   
CB511680 Lysozyme C Fwd CACCGACTATGGCATCTTCC 58 129
   Rev CTGACCGCCACTGTGATGTC   
CA767935 Cathepsin D Fwd CAGGCTGGTAAGACCATCTGC 58 127
   Rev TGTTGTCACGGTCGAACACAG   
DN048269 Complement C3a Fwd GAGGAAAGGTGAGCCAGATG 58 106
   Rev TGTGTGTGTCGTCAGCTTCG   
CA043655 Interferon regulatory factor-1 (IRF-1) Fwd GATGGGACCTGAACAAGGATG 58 132
   Rev GAAGGGAGTTCATTGCACAGC   
A064221 MHC-II alpha Fwd GAACACAGCAGGACCCACAC 58 134
   Rev TCTCCAGTCTGCCCTTCACC   
CX984314 Leukocyte cell derived chemotaxin (LECT-2) Fwd GCGAGATGGTCAAGTTTGGTC 58 115
   Rev TGATGCTCACGGTTTCCTCTG   
CK991004 Immunoglobulin heavy chain constant region (IGHC) Fwd AGATGGACGCTTGTGGATCTC 58 118
   Rev GGTCTGGAGCAATGGGACAG   
CB488287 Secreted protein acidic and rich in cysteine precursor (SPARC) Fwd CCAGCAGGTCCAGGGAGTG 60 156
   Rev TGCGTATGAGGGACTGGCTG   
CA055453 Glutathione peroxidase Fwd GCAATCAGTTCGGACATCAGG 60 131
   Rev GTCCTTCCCATTCACATCCAC   
CA050443 C1q-like adipose specific protein Fwd GTGATGACATTTTTGAAGATCAGG 60 104
   Rev AATAAGGAGAGAATGAAGGTGATC   
CB516930 CD209 antigen Fwd CCCATCTCCAATCCCCTTCC 60 119
   Rev CCTGCACAGCAAGGAACAGC   
CA051187 Mannose-binding protein C precursor Fwd CAAGAGGGGCTTGGTGTTGG 60 107
   Rev TGTTGTCAACATTGAGCCATGC   
CA039888 IgM heavy chain membrane bound form Fwd TCTGGGTTGCATTGCCACTG 60 121
   Rev GTAGCTTCCACTGGTTTGGAC   
CB492684 Annexin A1 Fwd AGGAAGGGAACAGACTGCTC 60 120
   Rev AATAGCCTTTGCCACATCCAC   
CB503743 CC chemokine (CCL 19) Fwd CCATGTAGCAGCAAGCACAG 66 128
   Rev GGCAGCTATCCGACATCCTC   
CB510333 Cd 63 Fwd AACAGTCTGACACCCCATCTG 58 97
   Rev TGTGCCAGACTCCTGCTGTG   
CA056108 C type Lectin receptor A (CTL) Fwd ATCCTGCACAGCAAGGAACAG 58 128
   Rev TTGTCCACCCATCTCCAATCC   
CK990996 Metallothionine Fwd GGACAGCAGGGGCAGCAAC 58 128
   Rev GCGATCAAAAACTGGAACATGG   
CA058146 Putative complement factor D Fwd GAATCCATCGGCTGTACGAAG 64 115
   Rev CCGTTGGTGTGTAATGGGATG   
AY693393 CD8α Fwd CACTGAGAGAGACGGAAGACG 56 174
   Rev TTCAAAAACCTGCCATAAAGC   
DQ867018 CD4 Fwd GAGTACACCTGCGCTGTGGAAT 58 123
   Rev GGTTGACCTCCTGACCTACAAAGG   
FJ263446 Interferon gamma (IFN-γ) Fwd CTAAAGAAGGACAACCGCAG 60 159
   Rev CACCGTTAGAGGGAGAAATG   
AF088999 Inducible nitric oxide sythase (iNOS) Fwd GGAGAGCCTTCTGGTTG 60 116
   Rev ACCTTAACTTGTTCCTGAGATAC   
EF165028 IL-10 Fwd CGCTATGGACAGCATCCT 59 84
   Rev AAGTGGTTGTTCTGCGTT   
BK001401 Arginase 1b Fwd CATTGGCTTGAGAGACGTGGAT 60 68
   Rev AGTAACCTTTGACACCCAGCAA   
  Arginase 1b (Probe)   6FAM-CAGAAGAGCACCATATCC   
AF321836 Elongation factor-1 Fwd GCTGTGCGTGACATGAGG 60 88
   Rev ACTTTGTGACCTTGCCGC   
EU418015 GATA-3 Fwd CCCAAGCGACGACTGTCT 60 61
   Rev TCGTTTGACAGTTTGCACATGATG   
  GATA-3 (Probe)   FAM-TTCCTGCCCGTCTTGC   
BT048013 Granzyme A Fwd GACATCATGCTGCTGAAGTTG 60 81
   Rev TGCCACAGGGACAGGTAACG   
BT059144 IL-6 receptor Fwd TCCCTCAGTGCTACCTCCTC 60 138
   Rev CCAGGTGTGGCTCTCTACTC   
GW574233 IL-17A Fwd TGGTTGTGTGCTGTGTGTCTATGC 60 136
   Rev TTTCCCTCTGATTCCTCTGTGGG   
BT058869 IL-17A receptor Fwd CAAGTGGAGGGCGATGTGTG 60 107
   Rev TCGGGCAGGAAGAGGTTGAG   
EU082211 TGF-β Fwd AGTTGCCTTGTGATTGTGGGA 60 191
   Rev CTCTTCAGTAGTGGTTTGTCG   
  1. * Annealing temperature; **Product