Skip to main content

Table 1 Identification of novel TOP mRNAs.

From: Regulation of the cardiomyocyte transcriptome vs translatome by endothelin-1 and insulin: translational regulation of 5' terminal oligopyrimidine tract (TOP) mRNAs by insulin

Gene Symbol Polysome RNA Total RNA 5' UTR
Atg12 1.28 1.03 Mouse: CTTCC GCCGCCGCCTCTCAGCAAGCAAAGATG
Rat:   CTTCC GCCGTCGACGCTCAGCAAGCAAGATG
Atp5g2 1.26 1.00 Mouse: CCCTCTCT GTCTTCTCTGCCCTGGGAGCAGCCCTCCTGCCTCGGCCCCTCACCCCTGAAAATG
Rat:   CCCTCTCT GTCTTCTCTACCCTGGGAGCAGCTCTTCTGCCTTTGCCCCTCACCCCTGAAAAATG
Ccnj 1.52 1.20 Mouse: CTTCC AGACTGAAGTTGCGGCGTCTGGCCGGGCGCACCTCCGGCTTCCATG
Rat:   CTTCC AGACTGAAGTTGCGGCGTCTGGCTGGGCGCGCCTCCGGCTTCCATG
Cnih 1.25 1.02 Mouse: CTTTCTCC GCTGGCCCCGGCGCGCCCGGCAGCTCCTCCCCGGCCATG
Rat:   CTTTCTCC GCTGGCCCCGGCGCGCCCGGCAGCTCCTCCCCGGCCATG
Gltscr2 1.28 0.91 Mouse: CTTCCTTT AAGAAGATG
Rat:   CTTCCTTT AAGAAGATG
Naca 1.25 0.96 Mouse: CTCTTTCT GCCGCCATCTTGGTTCCGTGATCTCCGCACAAAATG
Rat:   CTCTTTCC ACCGCCATCTTGGTTCCGTGTTCTCCGCACAAAATG
Pfdn5 1.28 0.90 Mouse: CTTCCTCTTC GGCAGTCCTCCTTCCCAACATG
Rat:   CTTCC GCTTCGGCATTCCTCCTTCCCAACATG
Rbms2 1.27 0.96 Mouse: CTCCCTCCCTTTCCTTC ACTCTCTTCTTTCTCTCTCTCAGCTCCGTAACAGTAAAGAAAAAATG
Rat:   CTCCCTCCCTTTCCTTC ACTCTCTTCTTTCTCTCTCTCAGCTCCGTAACAGTAAAGAAAAAATG
  1. Total and polysomal RNA from cardiomyocytes exposed to insulin (50 mU/ml, 1 h) or unstimulated cardiomyocytes (controls) were analysed using microarrays. Probesets corresponding to mRNAs with >1.25-fold increase in expression (FDR < 0.05) were identified. Results are the mean fold change in insulin stimulated samples relative to controls. Mouse and rat 5' UTR sequences were identified. The TOP sequence is in bold italics. Accession numbers are provided in Additional data file 6.