Skip to main content

Table 2 Primers used for qPCR.

From: Regulation of the cardiomyocyte transcriptome vs translatome by endothelin-1 and insulin: translational regulation of 5' terminal oligopyrimidine tract (TOP) mRNAs by insulin

Gene Accession no. Size (bp) Forward primer Reverse primer
Klf2 NM_001007684 96 CACACAGGTGAGAAGCCTTATCAT (874-897) CCGTGTGCTTGCGGTAGTG (952-970)
Klf6 NM_031642 89 GCTCCCACTTGAAAGCACATC (641-661) TTCTTGCAAAACGCCACTCA (710-729)
Klf10 NM_031135 149 CCATGAGCTGCGACTGGAA (183-201) TAAGGTGGAGTCAAACAGAATGCT (307-331)
Klf11 NM_001037354 85 CCTGATCTACCAAAGGACTTCCA (311-333) CTCATGGAGCCAACAGGGA (377-395)
Klf15 NM_053536 65 TGCGGCTGGAGGTTTTCA (1347-1364) TTCACACCCGAGTGAGATCGT (1391-1411)
Klf16 NM_001127604 79 TCACACCTGCGGACTCACA (516-534) CGGAACGGGCGAACTTCT (577-594)
Rps3 NM_001009239 94 AAAGTGGCCACAAGAGGTCTGT (280-301) CATAGCAGGCCCTTCGAACT (354-373)
Rps6 NM_017160 82 AAGGTAAGAAGCCCAGGACCAA (509-530) ATACGTCGGCGTTTGTGTTG (571-590)
  1. mRNA sequences (accession numbers provided) for established genes were obtained from the Rat Genome Database (http://rgd.mcw.edu, viewed at http://www.ncbi.nlm.nih.gov/entrez). Nucleotide positions are shown in parentheses for each primer.