Skip to main content

Table 1 Primers used for real-time qPCR analyses

From: Gene expression profiles in Atlantic salmon adipose-derived stromo-vascular fraction during differentiation into adipocytes

Gene Forward primer (5'-3') Reverse primer (5'-3') Accession number
Tumor necrosis factor alpha (TNFα) AGGTTGGCTATGGAGGCTGT TCTGCTTCAATGTATGGTGGG AF321836
Tumor necrosis factor (TNF) decoy TCTCCTGGTATTTGCGCTCTGTGGT TATAAGTCGGTGTGTGAGCGCCTGA CA351440
Arachidonate 5-lipoxygenase-activating protein (FLAP) TCTGAGTCATGCTGTCCGTAGTGGT CCTCCCTCTCTACCTTCGTTGCAAA CA369467
Tyrosine-protein kinase 1 (Jak1) GAGGAGTTTGTCCAGTTCGGTCCGT CATGCACCAGCTTCTTATCCTCCAG CA368994
Programmed death ligand 1 (PD-L1) TCAACGACTCTGGGGTGTACCGATG TCCACCTCATCTCCACCACGTCTC CA366631
Interleukin 13 receptor alpha 2 (IL13Rα2) TCTCTGAGCCGCTCAACCTGTCAT CGTTCCACGACAGCTTTATACGGA CA348044
Leukocyte cell-derived chemotaxin 2 (LECT2) CTGTGTTGTCAGAGTGCGAGATGGT TACACACAATGTCCAGGCCCTGA EXOB2
Complement component 5 (C5) AGAACTCTTCCGAGTTGGCATGGT AGTGATGCTGGGATCCATCTCTGA CA364804
Proliferator-activated receptor gamma (PPARγ) CGTGTATCAAGACGCCAGCT TTGCAGCCCTCACAGACATG EU655708
Bone morphogenic protein 4 (BMP4) TCAAGTTGCCCATAGTCAGT CACCTGAACTCTACCAACCA FJ195610
Myogenic factor D (MyoD) CCGCAACACGAAGCAACTATTACAGC GGAACCCTCCTGGCCTGATAACAC AJ557150
CCAAT-enhancer-binding protein beta (C/EBPβ) CAAACTACATTACCAGGC GTTATGTGTTGCCAGTTG EU668996
CCAAT-enhancer-binding protein delta (C/EBPδ) TTGGGCGGTGGAGCCTAT TTTCCTCGCCCGTGTCAT EU668997
CCAAT-enhancer-binding protein alpha (C/EBPα) AGACCTCGGCGAGATTTGT TGTGGAATAGATCAGCCAGGAA EU668995
Hexokinase (HK) GCTGAAGACCAGAGGCATCTTTGA GCTGCATACCTCCTTGACGATGAT AY864082
Glucose-6-phosphate dehydrogenase (G6PD) TGGTGCAGAACCTCATGGTCCTCA ATCCCGGATGATTCCAAAGTCGTC BT044902
Phosphofructokinase (PFK) AATCCATCGGCGTTCTGACAAGC GCCCGTACAGCAGCATTCATACCTT BT059256
Pyruvate kinase (PK) TGCCTTCATTCAGACGCAGCA CAGATGATTCCGGTGTTGCGA BT043851
Malate dehydrogenase cytoplasmic (MDHC) AGACGTCCACCACTGCAAGGTCAA TTAACAGCGTCGAAGCAGGCCA BT043497
Cytosolic phosphoenolpyruvate carboxykinase (PEPCKC) AGGGCATGGACCAGGAACTCC GGGCTCTCCATCCTGGGATGT BT072418
6-phosphogluconate dehydrogenase (PGD) CCAATGAGGCTAAAGGCACCAAGA CCAGCTTGTCGATGAAGTCATCCA BT050391
Transketolase (TKT) TGCCATCTCCGAGAGCAACATC CCGTGGGAATGGCTCTGAACAT BT059642
Peroxiredoxin 1 (PRDX1) CACTGCTGTGGTGGATGGACAGTT CCAGCGGGTAGAAGAAGAACACCA est02b08
Glutathione peroxidase 2 (GPX2) TGTACCTCAAGGAGAAGCTGCCGT ATTAAGGCCATGGGATCGTCGC est04e05
Activating transcription factor 6 (ATF6) CTCACACCATCAAAGCTACAGCGA GTGTCGCCTCGTCGATTTAACTCA CA367172
X-box binding protein 1 (XBP1) CGACTCAAATTCGACAACTGGGC TTTCTGTCTCTGGCTGTCTGGGCT CA385697
Microsomal triglyceride transfer protein (MTP) CAAAGACCAGCGTCAACAACAA CGCCTCTGTCTCAAAGCTCACT CA042356
78 kDa glucose-regulated protein (GRP78) GTGCAGCATGACATCAAGTA CTCTTCTTCTCGATAACCTT CA368961
Cluster of differentiation 36 (CD36) GGATGAACTCCCTGCATGTGA TGAGGCCAAAGTACTCGTCGA AY606034
ATP-binding cassette transporter 2 AGCGGGGGAAACAGTAGCAGGA GCCTGGTCTTGAGATTGTGGGTGT CA343913
Lipoprotein lipase (LPL) TGCTGGTAGCGGAGAAAGACAT CTGACCACCAGGAAGACACCAT BI468076
Fatty acid(FAS) TGCCTCAGCACCCTACTCTG GCTTTACAACCTCAGGATTGGC BT048827
18S TGTGCCGCTAGAGGTGAAATT GCAAATGCTTTCGCTTTCG AJ427629
Elongation factor 1A (EF1A) TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG BG933853
Eukaryotic translation initiation factor 3 subunit 6 GTCGCCGTACCAGCAGGTGATT CGTGGGCCATCTTCTTCTCGA CX040383