Skip to main content

Table 1 List of primers and annealing temperatures (Tm)°C used in qRT-PCR, and NCBI accession numbers

From: Transcriptional responses in Honey Bee larvae infected with chalkbrood fungus

Gene and GenBank number Tm°C Forward Primers 5'-3' Reverse Primers 5'-3'
Abaecin [U15954] 65°C GGTAGTGATATTTATCTTCGC TTGAGGCCATTTAATTTTCGG
Defensin-1 [U15955] 65°C GTTGAGGATGAATTCGAGCC TTAACCGAAACGTTTGTCCC
Lysozyme-1 [XM_001120995] 67°C GGAGGCGAGGATTCTGACTCAATG TGTTGCATATCCCTCCGCTGTG
Hexamerin 70b [XP_392868] 67°C CCGCTCTTCAAATGTGGTCTAC GATAGGTAAAAGGTTTGTGGTTC
Vitellogenin [XM_392349] 65°C TTCTGATAAAGGCGTTGCTCAC CTCGTCGTCGGTCGGAACTT
Trypsin like Serine protease
[XM_393882]
65°C TTGTTTACCGGCGAAAAATC ATGTTCACGACCACATCCAA
Glycosyl hydrolase 18 [XM_397146.3] 67°C GTGGTGGCAAACAAGCTGAT CGCTGCAAAATTGTTCCACGA
MyD88
[XM_396644]
65°C GAGAGGTCTTGCTCATTTATGC TCTCAAGTTTATCCACCATTTCA
Actin [AB023025] 67°C GAAATGGCAACTGCTGCATC GAGATCCACATCTGTTGGAA