Skip to main content

Table 4 Sequences of the QRT-PCR primers used in this study.

From: Global transcriptional response to carbonic anhydrase IX deficiency in the mouse stomach

Gene symbol Description GenBank number Forward primer (5'-3') Reverse primer (5'-3')
Adipoq adiponectin, C1Q and collagen domain containing NM_009605 TCCTGCTTTGGTCCCTCCAC TCCTTTCTCTCCCTTCTCTCC
Car3 carbonic anhydrase 3 NM_007606 GCTCTGCTAAGACCATCC ATTGGCGAAGTCGGTAGG
Cela2a chymotrypsin-like elastase family, member 2A NM_007919 TGATGTGAGCAGGGTAGTTGG CACTCGGTAGGTCTGATAGTTG
Cela3b chymotrypsin-like elastase family, member 3B NM_026419 TGCCTGTGGTGGACTATGAA CAGCCCAAGGAGGACACAA
Cfd complement factor D (adipsin) NM_013459 AACCGGACAACCTGCAATC CCCACGTAACCACACCTTC
Cpb1 carboxypeptidase B1 (tissue) NM_029706 GGTTTCCACGCAAGAGAG GTTGACCACAGGCAGAACA
Cym chymosin NM_001111143 ATGAGCAGGAATGAGCAG TGACAAGCCACCACTTCACC
Dmbt1 deleted in malignant brain tumors 1 NM_007769 GCACAAGTCCTCCATCATTC AGACAGAGCAGAGCCACAAC
Egf epidermal growth factor NM_010113 GCTCGGTGTTTGTGTCGTG CTGTCCCATCATCGTCTGG
Il1rl1 interleukin 1 receptor-like 1, transcript variant 2 NM_010743 ATTCTCTCCAGCCCTTCATC AAGCCCAAAGTCCCATTCTC
Pkp4 plakophilin 4, transcript variant 1 NM_026361 GAACATAACCAAAGGCAGAGG GGTGGACAGAGAAGGGTGTG
Pnlip pancreatic lipase NM_026925 CCCGCTTTCTCCTCTACACC TCACACTCTCCACTCGGAAC
Sftpd surfactant associated protein D NM_009160 CCAACAAGGAAGCAATCTGAC TCTCCCATCCCGTCCATCAC
Slc9a3 solute carrier family 9 (sodium/hydrogen exchanger), member 3 NM_001081060 TGACTGGCGTGGATTGTGTG ACCAAGGACAGCAGGAAGG
Actb actin, beta NM_007393 AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT
Hprt hypoxanthine guanine phosphoribosyl transferase NM_013556 AGCTACTGTAATGATCAGTCAACG AGAGGTCCTTTTCACCAGCA
Sdha succinate dehydrogenase complex, subunit A NM_023281 GCTTGCGAGCTGCATTTGG CATCTCCAGTTGTCCTCTTCCA