Skip to main content

Table 2 Expression levels and the origins of the top 20 highly expressed putative novel miRNA identified in the human and rhesus macaque brain transcriptomes

From: Comprehensive survey of human brain microRNA by deep sequencing

Human
Mature sequences Mapped reads Mapped region annotation Novel miRNA-star
AUCAUACAAGGACAAUUUCUUU 56157   hsa-mir-539*
AAUCAUUCACGGACAACACUUU 26634   hsa-mir-382*
ACCUUGGCUCUAGACUGCUUACU 13153   hsa-mir-212*
UGGGCUGUAGUGCGCUAUGCCGAU 8775 MER11B  
GCGUUGGUGGUAUAGUGG 5183 tRNA-Gly-GGA  
CAGGCAGUGACUGUUCAGACGUC 3586   
GUCUCUGUGGCGCAAUCGGU 3467   
UGUAGGGAUGGAAGCCAUGAAA 3170   hsa-mir-135a*
UGGGCUGUAGUGCGCUAUGCC 1437 7SLRNA  
AGUUGGUCCGAGUGUUGUGGGUUAUU 1413 HY5 hsa-mir-1975*
AAUCUGAGAAGGCGCACAAGGUUU 958 LTR16D  
AGAGGUUUUCUGGGUUUCUGUUU 832   hsa-mir-329*
AAUGUGUAGCAAAAGACAGA 746   hsa-mir-511*
AUCCCCAGAUACAAUGGACAAU 719   
GGAGGAACCUUGGAGCUUCGGCA 695   
GCUCUGACUUUAUUGCACUACU 686   hsa-mir-301a*
AUAUACAGGGGGAGACUCUUAU 636   hsa-mir-1185*
UGGUCGACCAGUUGGAAAGUAAU 601   hsa-mir-412*
AGGCAUUAGAUUCUCAUUAGGA 562 MER1A, MER1B  
AUAGGACUCAUAUAGUGCCA 531   
Rhesus macaque*
Mature sequences Mapped reads Mapped region annotation Novel miRNA-star
CCCCCCACUGCUAAAUUUGACUGGCUU 243332 HY4  
AAUCAUUCACGGACAACACUUU 33573   hsa-mir-382*
GAGAGAUCAGAGGCGCAGAGU 18711   
AUCAUACAAGGACAAUUUCUUU 16465   hsa-mir-539*
AAGUUUCUCUGAAUGUGUAGA 12107 U3  
CUGUGGUUCCUGUAUGAAGACA 11261   
UGUAGGGAUGGAAGCCAUGA 5546   hsa-mir-135a*
ACUGGACUUGGAGUCAGAAG 5503 MIRb  
GCAUUGGUGGUUCAGUGGUAGAAUUC 4916 AluMacYa3  
GGGGGCCGAUACACUGUACGAGA 3972   hsa-mir-128*
GUAAUGGUUAGCACUCUGG 2008 AluSx, Zaphod  
AAUAUACAGGGGGAGACUCUUAU 1912   hsa-mir-1185*
UGGUCGACCAGUUGGAAAGUAAU 1526   hsa-mir-412*
GCUCUGACUUUAUUGCACUACU 1476   hsa-mir-301a*
UGAGUCUGUAAGAAAAGAGGAG 1472   
AAUGUGUAGCAAAAGACAGAAU 1073   hsa-mir-511*
AGGGACUUUUGGGGGCAGAUGUGU 1068   hsa-mir-365*
GGAGACUGAUGAGUUCCCGGGA 922   hsa-mir-873*
CAACAAAUCACAGCCGGCCUCA 919   hsa-mir-7*
AAUCUGAGAAGGCGCACAAGGUUU 852 LTR16D  
  1. * miRNA annotation of rhesus macaque used for labelling of the identified novel miRNA-star sequences is based on human annotation by mapping of macaque miRNA precursors to the human genome by the reciprocal LiftOver.