Skip to main content

Table 3 Expression levels and the origins of the top 20 highly expressed non-conserved putative novel miRNA identified in the human brain transcriptomes

From: Comprehensive survey of human brain microRNA by deep sequencing

Mature sequences Mapped reads Mapped region annotation
UGGGCUGUAGUGCGCUAUGCCGAU 8,775 MER11B
GCGUUGGUGGUAUAGUGG 5,183 tRNA-Gly-GGA
UGGGCUGUAGUGCGCUAUGCC 1,437 7SLRNA
AAUCUGAGAAGGCGCACAAGGUUU 958 LTR16D
AAUGUGUAGCAAAAGACAGA 746  
GGAGGAACCUUGGAGCUUCGGCA 695  
AGGCAUUAGAUUCUCAUUAGGA 562 MER1A
AUAGGACUCAUAUAGUGCCA 531  
UGGUAGAAUUCUCGCCUGCC 497 tRNA-Gly-GGY
CUUCUGCAUGGACUAGACAUUG 429  
AGAGGUGUAGAAUAAGUGGGAG 309 LSU-rRNA_Hsa
AUAUACAGGGGGAGACUCUCAU 297  
CAAAGACUGCAAUUACUUUUG 269 MADE1
CAAAAGUGAUUGUGGUUUUUGC 258 MADE1
CAGGGCUGGCAGUGACAUGGGU 248  
UGGUAGAAUGACAGGCCACG 242  
AGGGGGCGGGCUCCGGCG 240  
AGAAGUUUCUCUGAACGUGUAU 231 U3
AGAAGUUUCUCUGAACGUGUAA 186 U3
CUGACACUUCUCAGAAUUCUUA 166