Skip to main content

Table 5 Strains and oligonucleotides used in this study

From: ChIP on Chip: surprising results are often artifacts

Strain or oligonucleotide Relevant characteristic(s) or sequence Source or reference
Strains   
   E. coli MG1655 F-λ rph-1 (wild type) Guyer et al., 1981; Jensen, 1993
   MG1655 ΔseqA ΔseqA10 Torheim et al., 2000
Oligonucleotides   
uvrDfw AGTTCCCGCAGGTGTTTATC  
uvrDrv GTCAGCGTCAGTTTCTGCAT  
uvrDprobe AGACGCCCGCCTTCATCCAG (5' FAM - 3' TAMRA)  
yahEFfw CCATCGAGACGATCAAAGAA  
yahEFrv CAGCATCTGGCTTTGTTGTT  
yahEFprobe AACTCGCGTCCTTCGGCAGC (5' FAM - 3' TAMRA)  
rpsDfw AAGTTGATGCTGGCAAGATG  
rpsDrv TAAAGCTCGACGATCAGGTG  
rpsDprobe TCAGAACGCTCCGGCTTACGC (5' FAM - 3' TAMRA)