Skip to main content

Table 5 Primer sequences for transposon display of D. pulex retroelements.

From: LTR retroelements in the genome of Daphnia pulex

Oligos Family Primary primer Secondary primer
Primers Dpul_D16 CGTTAAGCCAGACCCACAGT AGCGCCATCTCTCACCTATC
  Dpul_D5 AGGCTACGGCCTTCAGTTTT TCTCTCTCATTCCTTCCTTG
  Reverse primer GTAGACTGCGTACCAATTC  
Adaptors Adaptor Top CTCGTAGACTGCGTACC  
  Adaptor Bottom AATTGGTACGCAGTCTAC