From: Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata)
ID | miRNA(3'-5')/mRNA(5'-3') | Target unigene no. (number of mismatches) | Target protein | Target function | Conserved gene in other plants (E-score) |
---|---|---|---|---|---|
ctr-miRn1 | 3'AACGAGACGUUGAACUAGAGA5' | No | Â | Â | Â |
ctr-miRn2 (R) | 3'UACUACCAUUGAGUUAGAAUU5' | Â | Â | Â | Â |
 | AUGAUGGUAACUCAAUCUUAA | 24238 (0) | disease resistance protein (NBS-LRR class) | defense response | Populus trichocarpa (2e-58) |
ctr-miRn3 (R) | 3'UCCGUAGUGUCUGUAGUAAUA5' | Â | Â | Â | Â |
 | AGGCAUCACAGACAUCAUUAU | 20080 (0) | disease resistance protein (NBS-LRR class) |  | Populus trichocarpa (5e-007) |
ctr-miRn4 (R) | 3'AACGAUCAGAGAACGCCAGAU5' | Â | Â | Â | Â |
 | UUGCUAGUCUCUUGCGAUCUA | 17900 (1) | disease resistance protein (NBS-LRR class) | defense response | AT3G14470 (2e-56) |
ctr-miRn5 | 3'UUGGAGCUGGAGCCUGGAAGU5' | No | Â | Â | Â |
ctr-miRn6 | 3'UAAAUGUUGAGAGGAUUUGGC5' | No | Â | Â | Â |
ctr-miRn7 | 3'AAAGAGGGAGAAAAGUCGGCGAGU5' | No | Â | Â | Â |
ctr-miRn8 | 3'AGAGCACGAAGAGAUGUGGAU5' | No | Â | Â | Â |
ctr-miRn9 | 3'UAAGUUGACAAUAUAGGGAUU5' | No | Â | Â | Â |
ctr-miRn10 | 3'ACCGGUCGAGAGUACUUCUUU5' | Â | Â | Â | Â |
 | UGGCCAGCUCUCAUGAAGAAA | 42150 (0) |  |  |  |