Skip to main content

Table 1 Vertebrate primer pairs tested.

From: An In silico approach for the evaluation of DNA barcodes

Barcode name Primer Name Sequence Fragment size * Developed for Reference
COI      
COI-1 FF2d TTCTCCACCAACCACAARGAYATYGG 655 Fish [18]
  FR1d CACCTCAGGGTGTCCGAARAAYCARAA    
COI-2H LCO1490 GGTCAACAAATCATAAAGATATTGG 658 mainly Arthropods [1]
  HCO2198 TAAACTTCAGGGTGACCAAAAAATCA    
COI-2 C_VF1LFt1 WYTCAACCAAYCANAANGANATNGG 658 Fish [18]; modified from [1]
  C_VR1LRt1 TARACTTCTGGRTGNCCNAANAANCA    
COI-3 C_FishF1t1 TCRACYAAYCAYAAAGAYATYGGCAC 652 Fish [18]
  C_FishR1t1 ACYTCAGGGTGWCCGAARAAYCARAA    
Uni-Minibar UniMinibarR1 GAAAATCATAATGAAGGCATGAGC 130 Eukaryota [20]
  UniMinibarF1 TCCACTAATCACAARGATATTGGTAC    
Cyt- b      
MCB mcb398 TACCATGAGGACAAATATCATTCTG 472 All Vertebrates [30]
  mcb869 CCTCCTAGTTTGTTAGGGATTGATCG    
cytM L14841 CCATCCAACATCTCAGCATGATGAAA 359 All Vertebrates [31]; modif. from [26]
  H15149 CCCCTCAGAATGATATTTGTCCTCA    
16S      
16Sr 16Sar CGCCTGTTTATCAAAAACAT 573 Mammals [27, 28]
  16Sbr CCGGTCTGAACTCAGATCACGT    
16Sr2 16Sa2 CGCCTGTTTACCAAAAACAT 573 All Vertebrates this study, modif. from [28]
  16Sb CCGGTCTGAACTCAGATCACGT    
16Smam 16Smam1 CGGTTGGGGTGACCTCGGA 140 Mammals, ancient DNA [21]
  16Smam2 GCTGTTATCCCTAGGGTAACT    
  1. * as reported on the original paper.