Skip to main content

Table 5 Primer sequences (5' to 3') for the 14 qRT-PCR validation assays including 18 S, actin and eukaryotic elongation factor [TC11706] housekeeping primer sets utilised for normalisation

From: Comparative microarray analysis of Rhipicephalus (Boophilus) microplus expression profiles of larvae pre-attachment and feeding adult female stages on Bos indicus and Bos taurus cattle

  Anneal Temp° C Forward Reverse
a 18 S AFO-18656-363 60 CCTGAGAAACGGCTACCACATC GTGCCGGGAGTGGGTAATT
a TC11706 60 CAAAGGACTCAAGGACTCTCTGC ACGAGAACTGGTCAGTAAAGAAGC
a Actin 60 GACATCAAGGAGAAGCTYTGC CGTTGCCGATGGTGATS
CK173243 60 ACGAGTTGACTGATTTGAATGTGG CAGGGAGGTACTGCTAGTGTCG
TC5847 60 CAGCATTTAGTGGTATCCGTAGC GTGGATACGGAGGAGGATATGG
CK174565 60 AGGGATACAACCACAACTCAGG CGAAAGAAGACTGTCCGAATCC
TC9363 60 CATTTTCTGACGATAATTGCTACG CAGCGTACTCATTGAACTTCTCC
TC9228 60 CTACTAGCTCTCGCCTTTCTCG CAGTAAGTCTCGTACGGGAAGC
TC13140 60 CACTTTAGTTCGCAGTCTGTGG GTTCACGATAGAGACATGAAGACG
TC5872 60 AGGGATACAACCACAACTCAGG CGAAAGAAGACTGTCCGAATCC
TC9672 60 CGGTTCTGAGAAATTATTGAAGC ATCTATAGTGACTGCACCACTTGC
TC5931 60 TTGTCTATCTTGAACTTGGGAAGG CTGTCAAACAAGTTCTGACTATCG
TC6326 60 ACAGTCCTCTTTTGGAATGACG CACTTTGGAGCATATCTGTAATGG
CK184446 50 TCAGCTTGTCTATCTTGAACTTGG CTGTCAAACAAGTTCTGACTATCG
TC12051 60 AGGCCTATTACATGATGCTCTACC TGTCAATTTATTGAGTTGCGTAGC
TC9814 60 TAAAGGCTGGAGTATCCGAATG GCAAGTTTGTCAGGATTGTACG
TC8147 50 GAATTTCAGAGAGGAATCAAGTGC GAACAGTTTCTTTCACGGAACC
  1. aHousekeeping genes utilised for normalisation of qRT-PCR