Skip to main content

Advertisement

Table 2 Primers used for qRT-PCR

From: Transcriptional profiling of host gene expression in chicken embryo lung cells infected with laryngotracheitis virus

Accession # Forward Primer Gene Symbol
  Reverse Primer  
AJ711110 TGGTGGCTCGTTACCACAAG VNN2
  TTCCCAAAGGGAGTCTCGAA  
AF070478 TCCCAAAACGCCAGAGAAAT MMP-13
  TCGCCAGAAAAACCTGTCCT  
AF062392 CAGCCCCAGTGAATTTCCTC MMP27
  GACGGTTGGCCTTTTACCTG  
X03509 CCAGGGGTATCTGGCACAAT CKB
  TCATGTTGCCACCTTTCTGC  
AJ309540 CCTGTTCGCCTTTCAGACCT IL6
  GCCAGGTGCTTTGTGCTGTA  
AF432506 CCTGTTCGCCTTTCAGACCT FABP4
  GCCAGGTGCTTTGTGCTGTA  
X65459 GGACAGCCACAACTTTGACG FABP7
  GCTGCTGATGATCACTGTGG  
AJ851480 TGATGCAAGCACACGACTTG ACSL1
  ACCCACCAGGGTATTTGTCG  
AJ720861 AGGTTCACCCAGATCCCAGA LSS
  CCACAGTCCCGTGTGCTAAA  
AJ719295 CTGTTTCCCGACGAGCTCAT INSIG1
  GGTACAGCAGGCCAACAACA  
AJ719718 GGCAGTGAACGACAGCGTTA SC4MOL
  TAAATGGCTGCTGCAGAGGA  
U09350 CGAAAGCAAATGGCTGTGAA VIP
  TGCTTCACCTCGAAGTTTGG  
U62026 GAATGCTGGCACCAGGAAA CENPF
  TCCGGAAAGGTTCCATCATC  
M16199 CGCTGGTAAAGATGGGGAAT IL8
  CTTGGCGTCAGCTTCACATC  
X02009 GATAGCGGCTGTGTGTTTCG LTF
  GAGGTCCCTGAGGTTGTTGC  
AJ004940 CTGAATTCAAGCGCAAGCAC HSPA8
  TGACAGGGTACGCTTTGCAC  
AF411083 GTTGCTTTGCTAACGCCTTG SFTPA1
  AGAGCTCCCAGACCAAGCAG  
X16881 TTCCACGGGGACTCAGAGAT CDC2
  TGCAAGGATTCCACATCAGG  
U12438 GTCAGCAGGCTGGAGGTCTT RFC2
  AGCAGAGGATGCTCCTCCTT  
Y14971 GGCTGTAGCTGCTGTCATGG CXC chemokine K60
  TATGCACTGGCATCGGAGTT  
NM_204305 GGCACTGTCAAGGCTGAGAA chGAPDH
  TGCATCTGCCCATTTGATGT  
  1. The first column indicates the NCBI accession number for designated genes, and the second column shows sequences for the forward and reverse primers. The gene symbols are provided in the third column.