Skip to main content

Table 6 List of the used oligonucleotides

From: Brain transcriptional stability upon prion protein-encoding gene invalidation in zygotic or adult mouse

FVB/N PrP-/- mice  
Name SEQUENCE (5' -3')
Prnp 5' CAACCGAGCTGAAGCATTCTG
Prnp 3' CGACATCAGTCCACATAGTC
scg5 5' CCTTTATGAGAAAATGAAGGG
scg5 3' GGACAGATTTCTTTGCCACA
Tg37xNFH-Cre mice  
Name SEQUENCE (5' -3')
Ifitm3 5' TCAGCATCCTGATGGTTGTT
Ifitm3 3' TGTTACACCTGCGTGTAGGG
AV451297.1 5' CCCGAAGCGTTTACTTTGAA
AV451297.1 3' CCCTCTTAATCATGGCCTCA
Erf1 5' TCGCTCCACCAACTAAGAAC
Erf1 3' AAACACGGGAAACCTCACC
Prnp Tg37 5' GAAGGAGTCCCAGGCCTATT
Prnp Tg37 3' GCAGGAATGAGACACCACCT
Glrx3 5' CATAAGCATGGTGTCCAAGG
Glrx3 3' TGCCTTCTCTGCTTCGTAGA
Riken D17 5' AAGCCTTCATAGCGAGTGGA
Riken D17 3' TTCCAGACAAGTGGACCTGA
Bace1 5' TCGACCACTCGCTATACACG
Bace1 3' CTCCTTGCAGTCCATCTTGAG
Fgf2 B 5' AGCGGCTCTACTGCAAGAAC
Fgf2 B 3' GCCGTCCATCTTCCTTCATA
Atp13a1 5' CGTGACAAGGGTGAAGATGG
Atp13a1 3' ATAGTAAGAGAAGGCATTCC
BB217622.2 5' CCAGTTCCGTCAAAGTACCC
BB217622.2 3' CATGCAGATCTTCAGGTCCA
β-actin 5' TGTTACCAACTGGGACGACA
β-actin 3' GGGGTGTTGAAGGTCTCAAA
  1. The sequences of the oligonucleotides used in the QPCR experiments are listed; including those of the housekeeping gene that was used in the three described analyses. The sets of primers for the Erf1, Glrx3, BB217622.2 and the AV451297.1 loci were designed within a single exon. All the other sets were designed over exon-exon borders.