Table 1 RT-PCR confirmation of microarray
From: Modulation of the maternal immune system by the pre-implantation embryo
Fold change Pregnant vs Cyclic | Primer Sequences | Â | Â | |||
|---|---|---|---|---|---|---|
| Â | Microarray | RT-PCR | Correlation | Forward | Reverse | Probe |
OXTR | -7.26 | -10.55 | 0.90 | cgtgcagatgtggagtgtct | ttgcagcagctgttgagg | UPL#162 |
OAS2 | 10.94 | 31.05 | 0.93 | tggacggtcaactacagttttg | ctgggtccaagatcacagg | UPL#69 |
SPP1 | 3.41 | 3.60 | 0.75 | aagttccgccgatctaacg | cctcactctctatgtgtgatgtgaa | UPL#82 |
CXCL11 | 5.23 | 6.95 | 0.83 | tgctgcaattgttcaaggtt | tctgccactttgactgctttt | UPL#81 |
IDO | 15.25 | 28.97 | 0.76 | acgtaggctttgctcttcca | gagatccaggcatcataagga | UPL#65 |