Skip to main content

Table 1 Families and characteristics of silkworm MITEs

From: Burst expansion, distribution and diversification of MITEs in the silkworm genome

Family TSD1 TIR Size (bp) AT content (%) No.FC2 No.FLC3(%) -ΔG4 Known family
BmMITE-1 WW TCGATGGCTCCAATGAACACTAC 234 68 216 44(17) 39 Novel
BmMITE-2 TA/AT TGAGTCGACTATTATCAAAG 278 67 419 2371(85) 66 Hoshidandy 5
BmMITE-3 TA GATATGTGTCGTTCG 306 54 12 34(74) 47 Stowaway-like
BmMITE-4 TWA GGGTCAATTCCCACTGAAAGAGCAGCGGC 567 44 9 7(44) 125 Tourist-like
BmMITE-5 TWA AGCCTTGTTCGCACTAAGCGAGTATTTTA
GTCGAGTACCGAGTAATTTAGTGGCTAAA
213 61 53 81(60) 74 Tourist-like
BmMITE-6 TWA GGGCCTGTGCACACCACGTTTTTTAA 270 52 11 8(42) 81 Tourist-like
BmMITE-7 TDA TGCTGGAACCACACTGCG 548 55 7 13(65) 93 Organdy 6
BmMITE-8 TA TATATCGACGCTTGAAAGGCAAAC 266 67 1364 147(10) 47 Stowaway-like
BmMITE-9 ATT GGTAGTTTTCCAATTACAG 418 63 75 88(54) 52 Novel
BmMITE-10 ATAT CGTCGCTGTCAAACCAAAATCTGCTATGTGCAA 258 70 142 159(53) 38 Novel
BmMITE-11 ATATAT GTGGGATT 238 67 1 15(94) 8 Novel
BmMITE-12 TTCATTT TTACTTTGCA 210 73 20 121(86) 14 Novel
BmMITE-13 NNNNNNNN CAAGGGCGGATCCAG 263 59 69 171(71) 32 Pegasus-like
BmMITE-14 NNNNNNNN CAGTGGCGGATTA 431 59 12 22(65) 38 Pegasus-like
BmMITE-15 NNNNNNNN CAGTGGCGTACCTA 300 65 0 9(100) 60 Pegasus-like
BmMITE-16 NNNNNNNN CAGTGGCGGATTT 265 55 18 25(58) 43 Pegasus-like
BmMITE-17 TTACTGTAT GCGCGCGAGTTCATGT 494 59 20 22(52) 53 Novel
  1. 1 N = A/T/C/G; W = A/T; D = A/T/G. 2 No. FC means the number of fragmentary copies. 3No.FLC indicates the number of full length copies, the number of the bracket is the ratios of full length copies in total of each MITE family. 4-ΔG means the average negative ΔG(kcal/mol) value of each MITE family. 5Hoshidandy was referred to the accession No. AB455941 in NCBI. 6Organdy was first discovered in silkworm by Komoto et al. [26]. MITE families were classified based on TIR, TSD and internal sequences.