Skip to main content

Table 1 Gene-specific primers*

From: The CAZyome of Phytophthora spp.: A comprehensive analysis of the gene complement coding for carbohydrate-active enzymes in species of the genus Phytophthora

Gene Forward primer sequence Reverse primer sequence Tm Amplicon Size
PITG_08590 CATCTGTCTGGGCAGCGTGT TTCATCGAGACCCACGAACG 65 190
PITG_08421 ATGGCACAACAGCAATGGGA GCCCAGCAATACCCAGCTTC 65 190
PITG_08910 TAACGGCAACGAGAATGCGA CAGTGCTGCTGGATTCGTCC 65 188
PITG_18907 CGTGGTTCGAGTCTTGCGAC AGCTCGCTGTTCTGCCACAC 64 184
PITG_08914 CGTCAGCTCTACGCACGATCA TGCTTCTGCCACACAACGC 65 194
PITG_02545 AGGCTCGTGTCTTCGGTTCC GCCCCTGCTCCTCTGTTGTT 64 190
PITG_08863 CGGCAACAAGAACGCTACCA TTGTCGTCCCAAGGTGTCCA 64 189
PITG_08912 TCAGCCACACTTGCTACGGC TGTTCTTGGTAGAGGCCGGG 65 197
PITG_08911 TCTTCGGCAAACTCGCTCAA CCTTGCGGGTGGATAACGTC 64 199
PITG_07333 GAGCTGGCAAATCAGACGCA TTCGGGTCGATGTTTTCGTG 65 185
PITG_10850 TCTGTGAAGGCAGGGACGTG ATAACTGCACCCAGCACGCA 65 182
PITG_02504 AACGGGCAGCAGACCTATCG GGACACATCAGCATCGGGTG 65 185
PITG_14190 TCCTGTTCAAACTCGTGCTG TCTGGGAACTTGGGGTGTAG 60 160
PITG_07334 TGCGCTACATGTTCCTTGAC ATGTGCTCCATCCCATTAGC 60 160
PITG_11976 GCTAAACGGAGATGGACTGC GCGAAAAAGTAACCGTGGAG 60 111
PITG_03543 TGATCGCAGACAGCTACGTC GAAGCGCATAGAAGTACCGC 60 174
  1. *Carbohydrate esterase gene sequences from Phytophthora infestans were used to design gene-specific primers for RT-PCR and qPCR. Gene names correspond to the descriptors given in assembly 1.0 of the P. infestans genome.