Skip to main content

Table 1 Common miRNAs identified in S. japonicum

From: Identification and characterization of microRNAs and endogenous siRNAs in Schistosoma japonicum

MicroRNA Name Mature Arm miR*a Most abundant sequence Len Expressionc (TPMb)
      AduMix schistosomulum P-valued
Sja-mir-71 5' Y UGAAAGACUUGAGUAGUGAGACG 23 16813 32629 0.
Sja-mir-7 5' Y UGGAAGACUGGUGAUAUGUUGUU 23 4256 9969 0
Sja-let-7 5' Y GGAGGUAGUUCGUUGUGUGGU 21 2650 2840 0
Sja-mir-2b 3' Y UCACAGCCAGUAUUGAUGAACG 22 4004 1104 0
Sja-mir-124 3' Y UAAGGCACGCGGUGAAUGUCA 21 1542 386 0
Sja-mir-36a 3' Y CCACCGGGUAGACAUUCAUUCGC 23 715 641 0.0263
Sja-mir-10 5' Y AACCCUGUAGACCCGAGUUUGG 22 238 440 0
Sja-mir-219 5' Y UGAUUGUCCAUUCGCAUUUCUUG 23 494 103 0
Sja-mir-8 3' N UAAUACUGUUAGGUAAAGAUGCC 23 159 78 0
Sja-mir-2a 3' Y UAUCACAGCCCUGCUUGGGACACA 24 163 10 0
Sja-mir-36b 3' Y CCACCGGGUAGACAUUCAU 19 9 11 0.2002
Sja-mir-1810 5' N CUAAUAGGGAACGUGAGCU 19 8 6 0.3083
Sja-mir-281 3' Y UGUCAUGGAGUUGCUCUCUAU 21 10 1 0
Sja-mir-76 3' Y UUCGUUGUUGAUGAAACUGG 20 4 1 0
Sja-mir-307 3' Y UCACAACCUACUUGAUUGAGG 21 4 1 0.0001
Sja-mir-923 5' N AAGCGGAGGAAAAGAAAU 18 1 1 0.1216
  1. aY indicates that the sequences from both strands of a miRNA* species were found, while N means that only the sequence from one strand of a miRNA* was identified.n
  2. bThe abundance value of each miRNA was normalized to "transcripts per million (TPM)". If the value after normalization was less than 1, the normalized value was set as 1.
  3. cThe expression of miRNA was the sum of the total counts of unique reads which was within ±2 nt variations of the mature miRNA on the precursor.
  4. dThe differentially expressed miRNAs were analyzed using general Chi-square tests.
  5. Len means length of miRNAs. Adumix means miRNA of parasites of mixed adult.