Skip to main content

Table 2 Intergenic primers

From: An Sp185/333 gene cluster from the purple sea urchin and putative microsatellite-mediated gene diversification

Primer1 Sequence Strand2 Notes3
1R CGAAGATAAGTAATTGGT AS ~300 bp 5'of each D1 gene
2F GTTCTGTTTTTAGTACCG S RC of 12R, located ~2.2 kb 3' of all D1 genes
6F TTGAGAGCTCGTCACGTG S ~900 bp 3' of the D1-b gene
7F TGCAATCATTTTACATATTACTGGTT S ~800 bp 3' of the A2 gene
9F GGGATTACATACCATACCGCA S ~1 kb 3' of the B8 gene
11F ATCCTTTGAAACAGCCCCTC S RC of 10R, located ~2.4 kb 3' of the D1-y gene
13F TGGGAAATACTGACTGCC S RC of 5R, located ~2.7 kb 3' of the E2 gene
17F4 TTTCCAATGTCCTTATTTACGACTTATA S qPCR primer with 18R1
21F AATGTATTCGGCAGCGAGGT S ~1 kb 3' of the D1 genes
5R GGCAGTCAGTATTTCCCA AS RC of 13F, located ~1.1 kb 5' of the D1-b gene
8R AAGCCTGCTGCTCAATCATC AS ~1.2 kb 5' of the A2 gene
10R GAGGGGCTGTTTCAAAGGAT AS RC of 11F, located ~1.1 kb 5' of the B8 gene
12R CGGTACTAAAAACAGAAC AS RC of 2F, located ~1 kb 5' of all D1 genes
14R AAGTGGTGGTAGGCTCAGTAGTA AS ~700 bp 5' of the E2 gene
18R4 ATGATTCACAGGTTTGTTGCCTC AS qPCR primer with 17F1
  1. 1F, forward; R, reverse
  2. 2S = sense; AS = antisense
  3. 3RC = reverse complement
  4. 4These primers amplify a unique region used to quantify the copy number of BAC plasmids in qPCR reactions.