Skip to main content

Table 6 Putative polymorphisms identified at miRNA target sites and inside miRNA mature sequences

From: A computational-based update on microRNAs and their targets in barley (Hordeum vulgare L.)

miRNA family miRNA name Unigene Unigene cluster annotation Putative Polymorphisms at miRNA target site (5'-3') Barley miRNA mature sequence (5'-3')
156 miR156 Hv.5875 protein coding (SBP domain) #GTGCTCTCT(C)CTCTTCTGTCA UGACAGAAGAGA GAGAGCAC (12)
  miR156 Hv.21387 SPL2 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 2) #ATGCTCTC(G)TC(T)TC(G)TTCTGTCA UGACAGAAG AG AG AGAGCAU (9-11-13)
164 miR164 Hv.28795 NAC domain containing protein #AGCAAGTGCCC(A)TGCTTCTCCA UGGAGAAGCAG GGCACUUGCU (11)
169 miR169 Hv.13681 CCAAT-binding transcription factor (CBF-B/NF-YA) family protein #CAGGCAACTCATCCTTGGCT(C)T AA GCCAAGGAUGAGUUGCCUG (2)
  miR169 Hv.9532 CCAAT-binding transcription factor (CBF-B/NF-YA) family protein #GGCAATTCATCCTTGGC(T)TT AAG CCAAGGAUGAAUUGCC (3)
393 miR393 Hv.2498 TIR1 (TRANSPORT INHIBITOR RESPONSE 1), ubiquitin-protein ligase #G(C)ACAATGCG(T)ATCCC(+CT)TTTGGA UCCAAA() GGGAUC GCAUUGUC (6-12-20)
396 miR396 Hv.9742 WRC, QLQ #GTTCAAG(A)AAAGCCTGTGGA UCCACAGGCUUUC UUGAAC(13)
408 miR408 Hv.20945 ARGONAUTE like superfamily #CAGGGCAG(T)AGGCAGTGCAG CUGCACUGCCUC UGCCCUG (12)
  miR408 AutoSNP contig 2094 Plastocyanin #CAGGGAAGAGGCA(C) GTGCGG CCGCACU(G) GCCUCUUCCCUG (7)
444 miR444 Hv.16297 /   *GCAGUUGCU(C) GCCUCAAGCUU (9)
818 miR818 Hv.11323 protein coding #CCGTCCCATAA(CC)TATAAGGG CCCUUAUAU UAUGGGACGG (9)
  miR1436 Hv.8351 protein coding #ACTCCCTCC(T) GTCCCATAAT AUUAUGGGACG GAGGGAGU (11)
  miR1436 Hv.11323 protein coding #ACTCCCTCCGTCCCATAA--(CC)T A-- UUAUGGGACGGAGGGAGU (2)
  miR1439 Hv.23816 exo-endo-phos superfamily # AATACTCACTCCGTCCCAAAA(G) U UUUGGGACGGAGUGAGUAUU (1)
  miR1439 Hv.11224 tatD-related deoxyribonuclease family protein #TACTCACTCCGTTCCA(T) AAA UUUU GGAACGGAGUGAGUA (4)
821 miR821 Hv.3660 GDH1 (Glutamate dehydrogenase) #TCAA(C)CAAAAAAGTTGAAT AUUCAACUUUUUUGU UGA (15)
1030 miR1030 Hv.14867 RNA recognition motif (RRM)-containing protein #TGGT(G)GCAGGTGCAGGTGCAGG CCUGCACCUGCACCUGCA CCA (18)
1119 miR1119 Hv.29226 /   *UGGC(-)A(C)CGGCGCGAUGCUCAGUCA(-)G(C) (4-5-23-24)
  miR1119 Hv.29225 protein coding #CTGAC(A)TGAGCATCGCGCCGTGCCA UGGCACGGCGCGAUGCUCAG UCAG (20)
  miR1119 Hv.27666 protein coding #C(T)TGAC(T/A)TG(A)A(G)GCA(T)TCGCGCCGTGCC GGCACGGCGCGAU GCUC AG UCAG (13-16-17-19-23)
  miR1119 Hv.23343 molybdenum cofactor sulfurase family protein, superfamily #CT(G)G(T)A(G) CT(C) GAGCATCGCGCCGTGCC GGCACGGCGCGAUGCUCA GUCA G (18-20-21-22)
  miR1119 Hv.29210 protein coding #T(G)GGCACG(A)GC(T)GCGAT(A)GCTCAG(A)TCAG(A) C UGAC UGAGCA UCGCG CC GUGCCA (1-5-11-16-18-24)
1120 miR1121 Hv.464 serine/threonine kinase #A(G)A(G)GAGCGTTTAGATCACTA UAGUGAUCUAAACGCUCUU (18-19)
  miR1121 Hv.6581 protein coding #TAAGAGCGTTTAGATCACT(C) A UA GUGAUCUAAACGCUCUUA (2)
  miR1121 Hv.6532 ATPase-Plipid, haloacid dehalogenase-like hydrolase family protein #TAAG(A)AGTGTTTAGATCACTACT AGUAGUGAUCUAAACACUC UUA (19)
  miR1121 Hv.5064 /   *UAGUACAAAGUUG(C)AGUCA (13)
1122 miR1128 Hv.14876 ARF-GAP DOMAIN, C2 superfamily #TTTG(T)GG(A)ACGGA(G)GGGAGTAGTA UACUACUCCCU CCGUC CC AAA (11-16-18)
  miR1133 Hv.12091 oxidoreductase, zinc-binding dehydrogenase family protein #TTTGGG(A)ACGGAGGGAGTAC(-)TAT AUAG UACUCCCUCCGUC CCAAA (3-16)
  miR1133 Hv.28555 serine/threonine protein kinase, PKc-like superfamily #TTTCGGACAGAGGG(T)AGTATAT AUAUACUC CCUCUGUCCGAAA (8)
  miR1135 Hv.18515 ubiquitin family protein #TTC(G)GGAATTACTTGTCGCA UGCGACAAGUAAUUCCG AA (17)
1134 miR1134 Hv.22973 octopine synthase binding factor1, ATBZIP53 (BASIC REGION/LEUCINE ZIPPER MOTIF 53), DNA binding/protein heterodimerization/sequence-specific DNA binding/transcription factor #TCTTCTTCTTCTTCTTG(C)TTC(---) TTG CAAGAAC AAGAAGAAGAAGAAGA (4-5-6-7)
  miR1134 Hv.9579 L-asparaginase, putative/L-asparagine amidohydrolase, putative #TC(G)T(C) TCTTCTTCTTGGTGTTGGTG CACCAACACCAAGAAGAAGAAG A (21-22)
  miR1134 Hv.26138 AWPM-19-like membrane family protein #TCTTCTTC(G)TTCTT(A)GTCGTTGTTG CAACAACGACA AGAAG AAGAAGA (11-16)
  miR1134 Hv.24001 dehydrin family protein #TTCTTCTTCTTGTTGTTTTT(-) G CA AAAACAACAAGAAGAAGAA (2)
  miR1134 Hv.8025 /   *UCUUCUUCUUUUGUUGUUGU(C)UG (20)
  miR1134 Hv.5763 /   *CUUC(G) UUCCUCUUGUUGUUGUUG (4)
1871 miR1871 Hv.28885 protein coding # C(T) AACATGATATCAGAGCCA UGGCUCUGAUAUCAUGUUG (19)
  1. Letters in bold refer to SNPs represented by at least two independent sequences, while the numbers in brackets refer to the position of the SNP in the sequence. Plus means insertion, minus means deletion.