Skip to main content

Advertisement

Table 7 Verification of FPC contig assembly by PCR amplicons designed hybridization markers.

From: Genomic tools development for Aquilegia: construction of a BAC-based physical map

Marker Homology Primer sequences # positive hits (# contigsa) # positive hits with expected amplicons
Aq_SR_Ctg_2 mlp-like protein 28 Fwd AGGTGATGGAACCTGTGAGG Rev CACAATCCATGTCACCAAGC 14 (3 +3sb) 14
Aq_SR_Ctg_8 No homology Fwd GGCTATATCCACCAGGCTGA Rev AAGGGCCAGCACTTTATCCT 12 (3) 10
Aq_SR_Ctg_22 Late embryogenesis-abundant protein Fwd ATCATCCAACCTTGCGTTGT Rev GGGACCGGAACTATCCAAAT 12 (2) 12
Aq_SR_Ctg_30 Ubiquitin-conjugating enzyme E2 Fwd GCCCAAATCAAGAAACCAGA Rev CCTTTATGGACCCTGGATCA 8 (1) 8
Aq_SR_Ctg_118 putative staygreen protein Fwd TGGGGTCCACTTAAAGATGC Rev GAGTTGGTTGGTTTGGTTCC 5 (3) 5
Aq_SR_Ctg_127 universal stress protein 1 Fwd AGTAACTGGGCAAGCAGCAT Rev ATGGTGATGCAAGGGAAAAA 6 (2) 6
Aq_SR_Ctg_133 ethylene-responsive transcriptional co-activator) Fwd ATCGCATCGTCATCAAACAA Rev TTCAGCAGGCGTACGACGAG 4 (2) 3
Aq_SR_Ctg_144 Benzodiazepine receptor-related Fwd ACACTACGACATGCCAACCA Rev TAGCCCAGCCCAACAAATAG 2 (1) 2
  1. aThe number of contigs where the positively hybridized BACs were located
  2. bMarker Aq_SR_Ctg_2 also hybridized to 3 singletons other than 11 clones in 3 different contigs