Skip to main content

Table 5 Primer sequences used in qRT-PCR

From: Use of a bovine genome array to identify new biological pathways for beef marbling in Hanwoo (Korean Cattle)

Probe ID Gene Name NCBI accession no. Forward primer (5'->3') Reverse primer (5->3')
Bt.5323.1.S1_at SH3 domain YSC-like 1 (SH3YL1) CB535095 ACCAACCCATAGAAGTGACAGCAC CGAAGCTTTCCTTCCCACCAATCA
Bt.15675.1.S1_at ADAM metallopeptidase with thrombospondin motif 4 (ADAMTS4) NM_181667 AGTTCGACAAGTGCATGGTGTGTG TGGTGACCACGTTGTTGTATCCGT
Bt.21021.1.S1_at TBC1 domain family, member 7 (TBC1D7) CB451394 CTTCGTGAACCAGCTGAACAGCAA CGGCAAAGCACTTCTTGAACCACA
Bt.2933.1.S1_at Hypothetical protein LOC788205 CK972377 GCCAAAGCAGCTGTCGGTAATGAA TCCATCACACCGCGAAGACTCTAA
Bt.9767.1.S1_a_at Squalene epoxidase (SQLE) CK949309 AGTAATCATCGTGGGATCTGGCGT ACCTGGGCATCAATACCTTCCACT
Bt.621.1.S1_at Cytochrome P450, family 51, subfamily A (CYP51A) BE664559 GTATGACCTCAACAACCCTGCCAA TGACCACGACGATGATGAAGACCA
Bt.23903.1.A1_at Unknown BP102962 ACACAGGCCGTGCAAACTAAACAC TCTTGATTTGCTGCTGGGACCTCT
Bt.22362.1.S1_at SH3-domain kinase binding protein 1 (SH3KBP1) CK774919 TGAGGGATGCACAGATGAGTGTGA TTGAAGGCTGGAGGGCACATCTTT
Bt.16752.1.A1_at ATP binding protein (TXNDC9) CB536841 TTCATCTGCTGATGGCCACACTC AGAGAATCCAGACTCTCCTCAGA
Bt.1020.1.S1_at CDC-like kinase 1 (CDClk1) CK848317 TTTAGGATGGTCCCAGCCATGTGA GCCCAAGAATCCTTTCCATCATTGCC
Bt.19107.2.A1_at Transcribed locus BE723026 CCATGAGAACTGACTCGGGAGTTT CAGGCTGTCTGGCAAGCAACAATA
Bt.28011.1.S1_at Unknown CK940528 AGGAAGAACCTTCTGTCCCAGCTT TTGAGACTTCCCAGGTCAAAGGCA
Bt.22718.1.A1_at Proteasome (prosome, macropain) activator subunit 4 CK945034 GCTGAGGTGTGGGTTTGTTTGAGT AAACTGGTCACAGGCAAACACG
Bt.19107.1.S1_at Transcribed locus BE723026 GACCCAAGAGTTGCTTAAGAGAGC ACCCTCAGTCCACAGATGATCAAG
Bt.25102.1.S1_a_at Hypothetical LOC509649 CK772143 TTCCTCCCACTGGTGAGCATCTTT TGTGTTGCTCAGTGTTCTCCTCCA
Bt.22038.1.S1_a_at Arginyl-tRNAsynthetase (RARs) CK947459 TTGAAGGCTGCTCAGACCTCTGTT TAAGCCGCTGTGTTTCCTCTGTCA
Bt.21268.1.S2_at Ribosomal protein S6 kinase, 70kDa (TUBD1) CK977623 CGTGACTGTAGATGGTGAAAGGGT TGCACACTCAGACTGAAGACAC
Bt.13342.1.S1_at Src-associated protein SAW (UTP15) BM030756 CTCATAGCCATCAATAGTTCAGTGC TCAAGTAGCAAATACTACAGTTTGTC
Bt.344.1.S1_at Major histocompatibility complex, class II D76416.1 TCACACCAGCACCCTCTGATCTTT TAAGCACGGCTTTCGGCAGTAGAA
Bt.21827.2.S1_at Thimetoligopeptidase 1 (THOP1) CB444022 AAGGTCTCCATCTGGAGGTGTTTG AACTCCCAGGAAAGGGCTGCATT
Bt.21794.1.S1_at Hypothetical protein LOC777601 CA034934 CATGAGACACAGGCGAAACACTGA TCTTTGGGAGAAAGGGAAACTGGG
G3PDH Glyceride 3 phosphatate dehydrogenase AY779626 GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA
IL17A Interleukin 17A CB432107 TCATCATCCCACAGAGTCCA GGAGAGTCCAAGGTGAGGTG
TNFα Tumor necrosis factor CK848164 GGCCATGGTATTGACATCCT GGATCTTCTCCACCACATCG
TGFβ1 Transforming growth factor beta 1 CK772652 ACTACATCTCGGCGCTCAGT GAAGGTGCAGGTGAAGTGGT