Skip to main content

Table 1 Macrosatellite primers

From: Expression, tandem repeat copy number variation and stability of four macrosatellite arrays in the human genome

Target Application Forward Reverse Size
Chr5 Probe ACTCGTGACGAACCGACTTG GCTTGTAGGCTTATGTCTGG 571 bp
Chr5 Probe TGATTCCTCCAGCTGGAAAG CAGCAAGAAGGATGGAATCC 789 bp
Chr13 Probe GGAAATCACGGAGACCGCAG GTTCCATTCCAATCGCCTTG 472 bp
Chr4/19 Probe GGAGGGTGGGTTTCTTGCAG AGACGTTGAGCCAGACTAAG 576 bp
Chr9 Probe GGGCAAATTTCGAGTGAAGG CCAGTTCCAGCGGTGATTTC 779 bp
Chr5 RT-PCR CAGGGTTGTCATCCTCTGAG CAGCAAGAAGGATGGAATCC 226 bp
Chr13 RT-PCR GGAAATCACGGAGACCGCAG ACAACGTGGGTGGCAGATAG 306 bp
Chr4/19 RT-PCR GGGTGGGTTTCTTGCACGTC CGGGGAAGTCTTCTTTGTGG 594 bp
Chr9 RT-PCR TGGTTGACGACTCGCGAGAG CAAAGCACCGGCCTAGATCG 154 bp
GAPDH RT-PCR GAAGGTGAAGGTCGGAGTC AGGTCCACCACTGACACGTT 729 bp
  1. Primers used in the current study to amplify the macrosatellites listed for probe generation or assessment of expression by RT-PCR analysis.