Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: From an electrophoretic mobility shift assay to isolated transcription factors: a fast genomic-proteomic approach

Name Sequence (5' - 3') Employment
Bxyn2p250f Biotin-TGATGAAAGGAGAACAACTTCTAGACTG Affinity Chromatography
Bxyn2p250r CAGTCTAGAAGTTGTTCTCCTTTCATCA Affinity Chromatography
CKT067 CACTCCACATGTTAAAGGCGCATTCAACCAGCTTC EMSA/Affinity Chromatography
CKT068 GAAGCTGGTTGAATGCGCCTTTAACATGTGGAGTG EMSA/Affinity Chromatography
Exp2488F GGATCC GACCGCATGGCGCACAAC Construction of p2488DBD
Exp2488R CTCGAG TCAACAGAATCCTCTCGGGTCG Construction of p2488DBD
Exp3151F GGATCC GAAGAAACCGCCAAGGCGC Construction of p3151DBD
Exp3151R CTCGAG AGATGTGTACGTCGGGTTTTC Construction of p3151DBD
Exp7236F GGATCC ACACACGACCCCAACGCC Construction of p7236DBD
Exp7236R CTCGAG CGCGAGGGGGTTTCCATTC Construction of p7236DBD
fltn2488f GGTACC ATGGCACAAGCCCTCGACATTTCC Construction of p2488
fltn2488r GCGGCCGC TCAACAGAATCCTCTCGGGTCGAAG Construction of p2488
LPxyn2f-FAM FAM-TGATGAAAGGAGAACAACTTCTAGACTGGGTAAATTGGTCAATGGCCAGCCGCTC FAM-labelled EMSA
LPxyn2r GAGCGGCTGGCCATTGACCAATTTACCCAGTCTAGAAGTTGTTCTCCTTTCATCA FAM-labelled EMSA
LPxyn2Mf-FAM FAM-TGATGAAAGGAGAACAACGGAGAGACTGGGTAAATTGGTCAATGGCCAGCCGCTC FAM-labelled EMSA
LPxyn2Mr GAGCGGCTGGCCATTGACCAATTTACCCAGTCTCTCCGTTGTTCTCCTTTCATCA FAM-labelled EMSA
Pxyn2af TGATGAAAGGAGAACAACTTCTAGACTG Radioactive EMSA
Pxyn2ar TGAC CAGTCTAGAAGTTGTTCTCCTTTC Radioactive EMSA
Pxyn2aMf TGATGAAAGGAGAACAACGGAGAGACTG Radioactive EMSA
Pxyn2aMr TGAC CAGTCTCTCCGTTGTTCTCCTTTC Radioactive EMSA
transkr2488f AGCTTCCACAAACATGACGCCG Transcript analysis
transkr2488r CATGGCGATTTCGAGCAGTCG Transcript analysis
transkr3500f CTCTTCAGGTCCTTATGAAGGTCG Transcript analysis
transkr3500r GAGTAGCTGTCCGATCCACG Transcript analysis
transkr3151f GATGTCTGAGGAATCTTCAAGCGC Transcript analysis
transkr3151r GGAGTCTTGCTTCGATTGCGG Transcript analysis
transkr7236f GTGTACCTGGACCTTGCGC Transcript analysis
transkr7236r CTGCTTCTCCTGGGGCG Transcript analysis
  1. The employment of the oligonucleotides used in this study is given. Underlined bases represent introduced restriction enzyme sites or bases added for labelling. Double underlined bases indicate introduced point mutations.