Skip to main content

Table 3 List of primers used for quantitative real-time PCR and sequencing

From: Comparative profiling of the transcriptional response to iron restriction in six serotypes of Actinobacillus pleuropneumoniae with different virulence potential

Target gene Forward primer Reverse primer
glyA CAAGCGAATGCAGCTGTTTA CTGTGATGCCGTAGAGGACA
pykA GTACGGATGCGGTAATGCTT GTACGGATGCGGTAATGCTT
tpiA CTACGAACCGATTTGGGCTA CCGCCGTATTGGATAATCAC
exbB1 CCGGAATTGCGACAAATAGT CCGTTCATTGGGTTATTTGG
tonB1 CATTGCATTGCCATAACCAG AAAAGCGCCTGAAAAGATCA
tbpA1 AGGAATGACGTTGGTTTTGC ATTGCAGGTAGGGCTGATTG
copA CTATGAAGCCAGCGTGATGA CCAAATAGAACCGCTTTCCA
tonB2 GCCTTGTACCGCATTAGGAA CTCAGCCTAAGCCGAAAGAA
hlyX TTTTACGTTGAGCGAACACG ACGCCGTAATTTGTTCTTCG
cirA TACGCTCTCCGGTGTGTATG GTTGCGGTAGAAGCACCTTT
ywbN TCGCAAATGGGCTTTAATTC CTTTCAGCCAACCGTCTTGT
hpuB (APL_1953) AACATCGTGTAAGCGCCTCT GCCCTCATCATCGGTATCAC
hpuB (APL_1954) ACGAAATGTTCTCCGGTACG GATAGCCGGTCGAAACGTAA
hpuB (APL_1955) GGTTCGGCAACCTTATTTGA CGTTCTAACCCGCGTAATTC
lldD AATGCCCTTGATTACCATCG GTAAACCGCATACGCTTGGT
hyaA TTTACCGGGTATGCCGATTA GTGTCCTTCATCGCCGTATT
hybB TAATACCGGCAAAGGCTGTC ACTTTCGCAAACTCGCCTAA
napB ACCCGTCGTGCTTGATACTT GGCTTATACCAACCCGCATA
nqrC CCGTAGCTAAAGGTGCTTCG TTAGCTCCCATTGCTGCTTT
fdxG TACTGTTCTGTCGGCTGTGG GACTTACCGGATGGTCAGGA
ykgE GTTTAAACGACCGGCAATGT AACAAACCTGTTGCGGTTTC
hpuB (APL_1954)* TCGGAGGAAAACTCGCTTTA TAACCACCGGTCGGAAAATA
  1. All primers were designed by Primer3 http://frodo.wi.mit.edu/primer3/ and purchased at DNA Technology A/S, Risskov, Denmark. *Primers used for sequencing.