Skip to main content

Table 2 Oligonucleotide Primers used for RT-qPCR Analyses

From: Recent transfer of an iron-regulated gene from the plastid to the nuclear genome in an oceanic diatom adapted to chronic iron limitation

Gene Forward Primer (5'→3') Reverse Primer (5'→3')
PETF AGGCCACCTCCCTCGACTAC GCGGCATCGACGATGAAG
FLDA CCGGCCTTTTCTACTCGACC TTGACGTCTCCGATGTCCTTC
PCY CTCCGCCCCTGCTTACG TCCCTTGCAGACAGTGACCTT