Skip to main content

Table 1 Spatial distribution of miRNAs in fifth-instar day 3 larvae

From: MicroRNAs show diverse and dynamic expression patterns in multiple tissues of Bombyx mori

No. miRNA Probe sequence (5'-3') HD BW ASG PSG MG FB OV TE HC MT Nor
1 miR-124 TAAGGCACGCGGTGAATGCCAAG + +          +
2 miR-1497 GCCCACCACCTGCTGCATGTA +           +
3 miR-286 AGCACGAGTGTTCGGTCTAGTCA   +         + NA
4 miR-263b CTTGGCACTGGGAGAATTCAC +           +
5 anti-miR-276-5p AGCGAGGTATAGAGTTCCTACGT   +         + NA
6 miR-5 CATATCACAACGATCGTTCCTTT   +         + NA
7 miR-282 ACAGACAAAGCCTAGTAGAGGCTAGATT   +         + NA
8 miR-29b GCACTGAATTCGAATGGTGCTA   +       +   + +
9 miR-283 CCCAGAATTACCAGCTGATATTTA   +    +      + +
10 miR-7 ACAACAAAATCACTAGTCTTCCA + +      + +    +
11 miR-9a TCATACAGCTAGATAACCAAAGA + +      +     +
12 miR-228 CCGTGAATTCTTCCAGTGCCATT + + + + +    +   + +
13 miR-92 GGACTCCCTACTAGAGTCAATTT   +      +    + +
14 miR-288 CATGAAATGAAATCGACATGAAA + +         + +
15 miR-274 ATTACCCGTTAGTGTCGGTCACAAAA    + +       + +
16 miR-278 AAACGGACGAAAGTCCCACCGA + +         + NA
17 miR-13a CCACATCAAAGTGGCTGTGATA + +         + +
18 miR-275 CGCGCGCTACTTCAGGTACCTGA + +      +   + + +
19 miR-10b-3p ACCTCTCTAGAACCGAATTTGT + +    +      + +
20 miR-10b-5p ACAAATTCGGATCTACAGGGT + +    +      + +
21 miR-133 CTACAGCTGGTTGAAGGGGACCAAATG + +     +     + +
22 miR-1 CTCCATACTTCTTTACATTCCA + +    + +     + +
23 miR-277 TGTCGTACCAGATAGTGCATTTA + + + +       + NA
24 miR-iab-4-5p TCAGGATACATTCAGTATACGT   +    + + + +   + +
25 miR-279 TCAATGAGTGTAGATCTAGTCA + +     + + + + + +
26 miR-281-3p ATAAAGAGAGCAACTCCATGACA + + + + +      + +
27 miR-281-5p ACTGTCGACGGATAGCTCTCTT +   + + +      + +
28 miR-252 CCTGCGGCACTAGTACTTAGGAA + +     + + +   + +
29 miR-307-3p TCACAACCTCCTTGAGTGAG            
30 miR-307-5p ACATCACACCCAGGTTGAGTGAGT + +     + +   + + NA
31 miR-12 ACCAGTACCTGATGTAATACTCA + + + + +      + NA
32 miR-184-3p GCCCTTATCAGTTCTCCGTCCA + +    + + + + + + +
33 miR-31a ACAGCTATGCCGACTTCTTGCCT + + + + + + + +   + +
34 miR-305 CAGAGCACCTGATGAAGTACAAT + + + + +   + + + + +
35 miR-276-3p AGAGCACGGTATGAAGTTCCTA + + + + + + +   + + +
36 miR-276-5p AGCGAGGTATAGAGTTCCTACGT   +          NA
37 miR-289 AGTCGCAGGCTCCACTTAAATATTTA + + + + + + + + + + +
38 let-7a TACTATACAACCTACTACCTCA + + + + + + + + + + +
39 miR-100 CACAAGTTCGGATTTACGGGTT + + + + + + + + + + +
40 miR-8 GACATCTTTACCTGACAGTATTA + + + + + + + + + + +
41 bantam AATTAGCTTTCACAATGATCTCA + + + + + + + + + + +
42 miR-200b CATCTTTACCTGACAGTATTAGA + + + + + + + + + + +
43 miR-2a GCTCATCAAAGCTGGCTGTGATA + + + + + + + + + + +
44 miR-317 ACTGAGATACCACCAGCTGTGTTCA + + + + + + + + + + +
45 miR-79 ATGCTTTGGTAATCTAGCTTTA + + + + + + + + + + +
46 miR-34b CAACCAGCTAACCACACTGCCA + + + + + + + + + + +
Total number of expressed miRNAs 36 35 19 19 22 19 22 19 15 40 36
  1. All expressed miRNAs confirmed by microarray and Northern blotting methods are summarized in this table. A normalized signal value ≥1,000 was regarded as the positive expression threshold. Nevertheless, only those having signals higher than 1,000 in at least four specimens are listed here as the confirmed members. The same tissues from females and males are unified here. The alpha-numeric order in the left most column is listed sequentially for easier comparison of the results in this file with the descriptions in the text. Abbreviations: +, expressed; -, not expressed; No. the alpha-numeric number; HD, head; BW, body wall; ASG, anterior silk gland; PSG, posterior silk gland; MG, midgut; FB, fat body; OV, ovary; TE, testis; HC, hemocyte; MT, malpighian tubule; Nor, Northern blotting; NA, not assayed.