Skip to main content

Table 1 Let 7 family of miRNAs are expressed strongly by hES-MSC within the cells. This table lists common transcripts in the intracellular samples in the high category of more than 10,000 transcripts showing a predominance of let 7 family of miRNAs.

From: Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of Hepatic Nuclear Factor 4 Alpha

Intracellular Transcripts Number (Sample 2) Intracellular Transcripts Number (Sample 1) Transcript Sequence miRNA Annotation
1076532 667868 TGAGGTAGTAGATTGTATAGTT hsa-let-7f
425364 363558 TGAGGTAGTAGTTTGTACAGTT hsa-let-7g
406433 342886 ACAGTAGTCTGCACATTGGTTA hsa-miR-199a-3p
179887 169479 TAGCACCATCTGAAATCGGTTA hsa-miR-29a
256612 164108 TGAGGTAGTAGGTTGTATAGTT hsa-let-7a
162041 133623 TGAGGTAGTAGTTTGTGCTGTT hsa-let-7i
145189 114380 TAGCTTATCAGACTGATGTTGA hsa-miR-21
51885 49588 TCAGTGCATGACAGAACTTGG hsa-miR-152
49042 48131 TGAGATGAAGCACTGTAGCTC hsa-miR-143
67564 46368 AGCTACATTGTCTGCTGGGTTTC hsa-miR-221
52911 39313 AGCAGCATTGTACAGGGCTATGA hsa-miR-103
28369 23084 AACCCGTAGATCCGAACTTGTG hsa-miR-100
26641 21523 TGAGGTAGTAGGTTGTATGGTT hsa-let-7c
29311 19314 TGAGGTAGGAGGTTGTATAGTT hsa-let-7e
15299 13189 TGGCTCAGTTCAGCAGGAACAG hsa-miR-24
13269 10037 TCCCTGAGACCCTAACTTGTGA hsa-miR-125b