Skip to main content

Table 1 List of 181 novel chickpea STMS markers developed in this study; the locus name, type of repeat motif, primer sequences, annealing temperature (Tm), expected product size (bp), number of amplified alleles (Na), and GenBank accession numbers are mentioned.

From: Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.)

S. No. Locus Repeat motif Primer sequence (5'→3') Tm(0C) Size (bp) Na GenBank Acc. No.
1 NCPGR101 (CT)18 TCTGCTCTTTGTGCAGAAGAAT/GAAATAATGCGTTCACTGTTG 59.3 291 1 EU877268
2 NCPGR102 (CA)12N19(CA)13 GCGTGGACTAACATCCAATA/TAAAAACATTGGTGGCAACT 55.4 240 1 EU877269
3 NCPGR103 (CT)2tc(CT)21 ACAACCATATACTTTTGGCG/TTAGATGAAAAACGGGAGAA 55.0 213 1 EU877270
4 NCPGR104 (GA)21 GCTAAAGGTAGATATGGGCA/GTGGACTACTCGGAATTCAT 54.3 221 1 EU877271
5 NCPGR105 (CT)16at(CT)7at(CT)3at(CT)3at (CT)3at(CT)3at(CT)18 TTTTTGTTAAGCCATCAAAGT/TTTCCCTTTTAGAATGATGC 54.5 261 1 EU877272
6 NCPGR106 (GA)39 ATTTGCCTTACATGGTGATT/ATTTGCTTTTCCTTTTCAGA 54.5 229 1 EU877273
7 NCPGR107 (CT)22 AAACTCAATATTGCCCTTCA/CCATAACTGGATTGAGCTTT 54.0 244 1 EU877274
8 NCPGR108 (CT)20(GT)16 AGTTCAAGCCTCATTGATGT/TGAAGAAGAATGGAGAAGGA 54.5 278 1 EU877275
9 NCPGR109 (CT)12cccc(CT)10 TAGCTCAAAGAGATAACCCG/AAAACAAATCACCTACCCCT 55.1 285 1 EU877276
10 NCPGR110 (AT)6(GT)4gc(GT)32at(GT)5 ct(GT)10 CAAGGTCAATTCGTAGAAGG/GAACGAGAGTTGGTATTGTTG 55.2 217 2 EU877277
11 NCPGR111 (CT)22 AATAACTCCATTTGGCTTGA/GCGGTAATTACACAATACAGG 54.5 247 1 EU877278
12 NCPGR112 (CA)9cg(CA)cg(CA)cg (CA)12 TTTTATTTCTCACCCACCAG/TGAGTTGCAACGAGAGTAGA 54.5 290 3 EU877279
13 NCPGR113 (CT)5ca(CT)17(CA)7ct(CA)5 ATTCTCTCTCTCTCTCTCTCTCGTG/CGGTAACATTCTCAACGGATA 58.0 299 1 EU877280
14 NCPGR114 (GA)3gg(GA)19 TAAGAGGGGACTTCACATTG/GCGTGGACTAACTACACCAG 55.0 279 1 EU877281
15 NCPGR115 (CT)18 TGGAGCCCAATTGATAGCTT/TGGACTACTCGCATTGTTGC 60.2 213 1 EU877282
16 NCPGR116 (GA)21 ATTTCCTTTCTTTACGGGAC/AGCGGATAACAATTTCACAC 55.4 295 1 EU877283
17 NCPGR117 (CT)23 GAACTTCTTCAATCTCACGG/CTAGCACGATGAAAGGATTC 54.5 199 1 EU877284
18 NCPGR118 (GT)12(GA)18 GAGTCGATTTCGTGTTGATT/ACGTGAAATTCCACCACTAC 55.5 224 1 EU877285
19 NCPGR119 (CT)8N10(CT)19 GTGGCTGCCTTTTCTTTCAA/TCAAAATACACCGGGGCTAA 60.1 234 1 EU877286
20 NCPGR120 (GT)20 GCCCAGTTTTTGGTATTTAG/TATGTTCTTTCTCACCCACC 54.7 300 4 EU877287
21 NCPGR121 (GT)4N8(GA)15 TGATTGTGGGGAACAGAAAT/TGTTGTTTGAAGTTCCGACTG 58.9 215 1 EU877288
22 NCPGR122 (GA)15g(GA)2(GA)8aa(GA)5 TGTTCTTTGGCTTGATTTCT/TTGTGAGGATAAGAACGACC 55.0 289 2 EU877289
23 NCPGR123 (CT)25 CTCTGCAGACTGAGGGTAAG/TCTGGAGGAGAAGAGACAAA 55.0 273 1 EU877290
24 NCPGR124 (CT)20 TTTGTAACTGATGAGTCCGC/ACTACAAGTTTGGACGAAGG 54.3 140 1 EU877291
25 NCPGR125 (CT)25 CGGTTTTGTGTATGGTGAGT/GCATACCATTGTCAACCATT 55.5 169 2 EU877292
26 NCPGR126 (CT)10N21(CT)12t(CT)3 AGAAGTGGGGACAAACCTTG/TGTGCATACCATGATTCTTCTG 59.1 324 1 EU877293
27 NCPGR127 (GA)18 CATAATGCAAGGGCAATTAG/CTCTTATCTTCATGTTGCCG 55.5 279 1 EU877294
28 NCPGR128 (CA)9cg(CA)2(CGCA)4 (CA)2N42(CG)4(CA)9 GCAATGAGCAACTTTTCCTT/ATTGGTGTAACTTTTCCGCT 56.2 290 3 EU877295
29 NCPGR129 (GT)21 ACGAAGAATTTAATACCGGA/GAGATTTGAGTTTGACGGTT 54.5 293 2 EU877296
30 NCPGR130 (CT)24tt(CT)2 GATACTGGTGGAAAAATGGA/CAAGCTCTTTCAGAATTTGC 55.5 245 1 EU877297
31 NCPGR131 (GA)18ta(GA)3aa(GA)3 CTATGCGAGGATTTCTCATC/ATACTCGGCAGACATCTGTT 54.3 290 1 EU877298
32 NCPGR132 (GT)13(GA)25 GAAGATCTCCGACGATGATA/CGGGGACTAACAAGTGTATG 55.5 242 1 EU877299
33 NCPGR133 (CT)19 TGAGTGAAAGGTGGAAAAGA/AAGTTCACCTACCAATGCAA 55.5 265 2 EU877300
34 NCPGR134 (GT)14(GA)22 CATCCTATGAGAGTTGTCCTCTT/TGTCTTTTTCACACTCTCTCTCTCTC 57.6 250 1 EU877301
35 NCPGR135 (CA)4cg(CA)5(CG)2(CA)5 (TA)5 GAGGAAACATTTCCGATTTC/TATGCTAATTGAATAGCGGC 55.5 234 1 EU877302
36 NCPGR136 (GT)7gc(GT)ac (GT)gc(GT)gg(GT)10 GGACTGAGTGAGTTCGTCTT/GTATCCTCGGTTTCCCTATC 54.0 132 2 EU877303
37 NCPGR137 (GT)6ct(GT)3ct(GT)3gg(GT)5 GTGATGCGACCATGTGAAAA/CGTGGACTAACACATGAGGA 58.0 287 1 EU877304
38 NCPGR138 (CT)2cc(CT)24ccc(CT)4 ATTCCAAATTGCTGTTGTTG/TGTGGATTTTAGTTGCAATG 54.5 213 1 EU877305
39 NCPGR139 (GA)40 TGGGTCTTATTGGGTTTGAT/CATGCATTTAGGATGAACCA 56.5 245 1 EU877306
40 NCPGR140 (GT)14gc(GT)gc(GT)gc (GT)10 ATTGGTTTGAGAAGTGATGG/TTTTATTTCTCACCCACCAG 55.0 264 2 EU877307
41 NCPGR141 (GA)8aa(GA)13aa(GA)9 ACTCAAAAGACAGCAAAGCA/AGCTTAGAGCACTCACATGC 55.5 211 1 EU877308
42 NCPGR142 (CT)24 TAACTCCATTTGGCTTGAGA/TAACCTTATATGGTAGGCGG 54.5 263 1 EU877309
43 NCPGR143 (GT)14(GA)22 TACTTCCCATCCCTCAGTAA/GAGTGAAAAGTTGAAAACGTG 54.5 220 1 EU877310
44 NCPGR144 (GT)5g(GT)5(GA)7 TCTGAACAAGGTTTTCCTCA/TTCATTTGTCCATCAACCTC 55.5 252 1 EU877311
45 NCPGR145 (CT)5(CACT)2(CT)10ca(CT)4N6(CT)4gtca(CT)11 CCATATGAAGATATTGTGGCA/ATCATGGCAAGAGGTAGGTC 56.3 316 1 EU877312
46 NCPGR146 (CT)18(CA)12 AACGTGAAATTCCACCACTA/GAGTCGATTTCGTGTTGATT 55.4 225 1 EU877313
47 NCPGR147 (CT)24(CA)15 TGTATGAAAACACTTTGACTCATT/CGATGATATTCTCAGCGAAC 55.5 219 1 EU877314
48 NCPGR148 (GA)12N5(GA)9 ACACAAGCCTATGCAATGA/GCTTGAGTTTATGCTTCTGG 55.9 285 1 EU877315
49 NCPGR149 (GA)27 TTAAAAATTCAGGGGGCTCA/AACTCACTACCCCTAGTAGCAAA 60.0 202 1 EU877316
50 NCPGR150 (AT)5(GT)16 GGACCCGACAACACTACTAA/GGGTTAAAGATGTGCCATAG 54.5 287 1 EU877317
51 NCPGR151 (CA)14(TA)9 AACTCTGTAATTTGCGACCT/GGAAATAACTTGTTGTTGGG 54.5 284 3 EU877318
52 NCPGR152 (GA)16 AAGCAGCCTTCTCTCCATCA/CGCGTGGACTAACTCTTGTTT 60.4 221 1 EU877319
53 NCPGR153 (CT)16 TGCCTCAAACTCCTACTCAT/AGTGGAGCTAGGGAAATACC 55.6 281 1 EU877320
54 NCPGR154 (CT)13N12(CT)4N6(CT)7N8(CT)9 CGCAACTTCAACGTCTCATT/GTGCAAAAGCAAAACTAGGG 58.9 271 1 EU877321
55 NCPGR155 (GA)18 GGGAAAAATAATGAGGAGGA/TGGCTCACAATTTTCTCTCT 55.0 281 1 EU877322
56 NCPGR156 (CA)12(TA)5 CGATTATGTGTCATCCCTTT/ATTTCAACGTCTCAACCATC 55.5 261 1 EU877323
57 NCPGR157 (CA)16(TA)3 TCCGTAACAGTGATGAACAA/TGGGATTACACTGGATAAGG 55.1 203 1 EU877324
58 NCPGR158 (CT)3tc(CT)14N3(CT)3t(CT)8 TAAAGCTGGAAACTCGAAAG/TAACCTTCCAATACCGAAGA 55.6 179 1 EU877325
59 NCPGR159 (GT)9(GC)4(GT)2gggc(GT)3(GC)2N36 (GCGT)4 (GT)9 TGTAACTTTTCCGCTGCTTGT/GGCAATGAGCAACTTTTCCT 59.3 285 1 EU877326
60 NCPGR160 (GT)12(GA)11 GTGGAGCCAAAAATCGACAT/CGGGCACGAAATATCTGAAG 59.9 241 1 EU877327
61 NCPGR161 (CT)17 ACCATCGCAATGCTTTGTTT/CCCTTTTACACAAGGCCAGTAA 60.5 238 1 EU877328
62 NCPGR162 (CT)17 GCGTGGACTATTCCTTCAGA/TAGTCGAGGAGTCAATCCGTA 57.8 139 1 EU877329
63 NCPGR163 (GA)47 CAAAACTCGCTCGAAACACA/TCCAAACTTTCTCTCTCTCTCTCTC 60.0 164 1 EU877330
64 NCPGR164 (CT)6ca(CT)14 CCATAACCATAACCCTTTCA/TCTTCTCCTAAGTTGATGGG 54.0 211 1 EU877331
65 NCPGR165 (GA)15 TCAGAAGAAAACGAAAGAGC/CAGCAACCTTAATTGGACAC 55.5 233 1 EU877332
66 NCPGR166 (CT)7(CA)11 TGGATTGTGGTATCCAAAAGG/CAGCATCATCAAAGGTGCAT 59.6 197 1 EU877333
67 NCPGR167 (AT)5(GT)13 AGATGCAGCGTTTTCCAGAG/CCTTCTTTTTCCTTCCCTTCC 59.7 247 1 EU877334
68 NCPGR168 (GA)31 TCCAATACCGAAGAGGCTCA/CGCGTGGACTAACGATTAACA 60.4 243 1 EU877335
69 NCPGR169 (CT)5(CACT)2(CT)10ca(CT)4N6(CT)4gtca(CT)11 CCTCCTTCTTGCTTACAAAG/CATGACAATAATGGTGAACG 54.6 256 2 EU877336
70 NCPGR170 (CT)18(CA)12 ACGTGAAATTCCACCACTAC/GAGTCGATTTCGTGTTGATT 55.9 224 1 EU877337
71 NCPGR171 (GA)30 AAAGACAGCAAAGCAAAGAG/AAAACACCATAAATTCCACG 55.0 205 1 EU877338
72 NCPGR172 (AC)14 TTGGTTGGGATTGTTACTTT/TCGCATTCCTAGACAATACA 54.0 300 1 EU877339
73 NCPGR173 (AT)4(GT)12 AATCTTTGGGGATAAAGGAG/ATGTGACCAAAGTAAGGGTG 54.5 266 1 EU877340
74 NCPGR174 (CA)11(TA)4 TGAGGGGTTGAGTGAATATC/GTTGGAAATAGTGTCACCGT 54.5 170 1 EU877341
75 NCPGR175 (CA)19taca(TA)8 AAAACGGGGTTTTACAGAAG/CGATAAAATCACAACCGAGA 56.0 232 1 EU877342
76 NCPGR176 (AT)6(GT)16 TTGAAAGGTGATGTGGAAAC/GGCAGTAAGGAGAAGAAGGA 56.3 234 1 EU877343
77 NCPGR177 (GA)19 GGGGAAAAATAATGAGGAGG/GGCACCCAATTTTCTCTTAC 56.1 253 1 EU877344
78 NCPGR178 (CA)6aa(CA)5 CCCTTAGATTAGTTGAAACCTG/ACTAACTCCGATGCATTCC 54.5 181 1 EU877345
79 NCPGR179 (CT)17 TACCACAAAGCTCTGCCTCCAT/GGAAAAGTGGAGTGGACAACA 62.0 335 1 EU877346
80 NCPGR180 (CA)4a(CA)10(TA)4 TCCGTAACAGTGATGAACAA/TGGGATTACACTGGATAAGG 55.0 283 1 EU877347
81 NCPGR181 (TA)5(TG)6cg(TG)6 GAAATGATGGAAGGTGATGT/AGGTTGGAGGAAGAAGAAAG 54.5 264 2 EU877348
82 NCPGR182 (CA)12(TA)2 CCCAAAGAAGACAAAACAAC/TCATTTAAGGCAGGTCAGTC 54.5 190 1 EU877349
83 NCPGR183 (GA)12ggata(GA)9 AAAACATTGGTGGCAACTCC/AGAGTCACACACACACACACACA 60.5 236 1 EU877350
84 NCPGR184 (AT)6(GT)16 TCACTGTGAAAATAGGAAATTTTA/CAGTGATGAAGCTGTTGTTG 55.5 252 1 EU877351
85 NCPGR185 (CT)17cg(CT)3 TCATGCATTTAGGATGAACCA/CGAACCCTAATTCTCCGTCA 59.4 242 1 EU877352
86 NCPGR186 (CA)14(TA)5 GTGCATCCATGGTAAAGATT/AACCAGAGTGTAGCCGAATA 55.0 228 2 EU877353
87 NCPGR187 (CT)9atc(CT)13 CCTTCACTGTCGGTTATGAT/TAACACAAGCCTATGCAATG 54.5 152 1 EU877354
88 NCPGR188 (TA)2tg(TA)3(TG)12 GTTAATTGAGTTGCGACGAG/TCTGTTTCCTTCCTTTTTCC 56.0 181 1 EU877355
89 NCPGR189 (CT)9;(CT)5 (CACT)2(CT)10 ca(CT)4N6 (CT)4 gtca (CT)11 TGGCACAATGTATGTATTGAA/ATGGCAAGAGGTAGGTCATA 54.5 297 1 EU877356
90 NCPGR190 (AT)7(GT)13 CCTTAGTGTATAAACCCGAAAC/GACCTGCTTGAGTTAGACCA 54.5 289 1 EU877357
91 NCPGR191 (TA)4(TG)13 TGGAATTAGTTGATGTGACAATGAG/ATTTCCCGCGTCTTTGAGAT 60.8 221 1 EU877358
92 NCPGR192 (TA)3(TG)12tt(TG)2 TGGGATTACACTGGATAAGG/TCCGTAACAGTGATGAACAA 55.1 203 1 EU877359
93 NCPGR193 (AT)9gtat(GT)9 CCGATAAAATCACAACCGAG/AAACGGGGTTTTACAGAAGG 58.3 232 1 EU877360
94 NCPGR194 (TG)6g(TG)5(AG)7 AGCCAAAAATCGACATAGAA/ATTTCATTTGTCCATCAACC 54.5 190 1 EU877361
95 NCPGR195 (CA)11ga(CA)5ta (CA)31cg(CA)5(TA)6 GGATGAACGAGAGTTGGTAT/CAAGGTCAATTCGTAGAAGG 54.0 221 4 EU877362
96 NCPGR196 (CT)17 TTGGGTCATTACCTTCATCT/CTCATCCTTGAGAGAAATCG 54.5 226 1 EU877363
97 NCPGR197 (CT)17 AAAGGGATCACAATTCAAAA/TAAAAATCGGGGTGTTACAG 54.5 188 1 EU877364
98 NCPGR198 (GA)18 TAGTAGGGGAAATGAAGGTG/GCGTGGACTACTAGCATTAAC 54.0 241 1 EU877365
99 NCPGR199 (GA)27 GGACATAGTAATCTCCGCTG/CCAACACCAACACCAACATA 55.5 196 1 EU877366
100 NCPGR200 (GA)24 TTCACACAACAACCTTTTCA/GGTGAGTTTCTTTTTCCCTT 55.0 250 1 EU877367
101 NCPGR201 (CT)13(CA)12 TATGCAAGCAATCCTTTAGC/TCTTTTGGAAACTAAGCCCT 55.5 269 1 EU877368
102 NCPGR202 (CT)25 AGGCCTTTTCCTTTTTACCT/GGAAAAATTCCCGATCATAC 56.5 259 1 EU877369
103 NCPGR203 (GA)31 GAAGAGTTCTGTTGCGGTAG/ATTGGTAATGGCTCAACATC 55.8 157 1 EU877370
104 NCPGR204 (CT)7(CA)17 TCTTGCCTTTACGTCGACAA/GAATCGATTAAGAAACGTGTGTG 59.2 181 1 EU877371
105 NCPGR205 (CA)17(TA)5 AAGCAAAAGGAAGCAAAGAA/AGTGGGTTGAGAAATTACGG 56.5 267 1 EU877372
106 NCPGR206 (GA)3ta(GA)7aa(GA)8 AACAACACTGGGTGAGAGAT/GATCCACATGCTACCATACC 54.3 252 1 EU877373
107 NCPGR207 (CA)10(CT)8 AGACAGGAGAAATGCTGTGG/GCAATGGATGAATGAAAAGG 57.5 281 1 EU877374
108 NCPGR208 (CT)24 AGCAAATATTTTGACCTTACACT/ACAGTTAAAAATTCAGGGGG 54.6 178 1 EU877375
109 NCPGR209 (GT)3gg(GT)5gg(GT)2(GA)7 ATTGTTTGTTGGAGTGATGG/CACGGTTTCATTGTCTTGTT 55.5 161 1 EU877376
110 NCPGR210 (GA)17 AAGGTAGACGTGTGCGTG/CCTGTTATGGAAGATAGGGC 55.5 224 1 EU877377
111 NCPGR211 (CT)16 ATCTTCATGTTGCCGACTCC/GCGTGGACTAACCACAAATTC 60.0 213 1 EU877378
112 NCPGR212 (GA)7(GT)12 CAGTCACTAAACAAGGACTGC/TCAAATCCCAAAATTGATTC 55.0 190 1 EU877379
113 NCPGR213 (CT)3(CA)12 TTCATGGATGTAATTCTCCC/CCCCACTATTTTCCACATAA 54.5 220 1 EU877380
114 NCPGR214 (CA)14(TA)5 ATTTCCCGTGTCTTTGAGAT/GGAATTAGTTGATGTGACAATG 54.5 225 1 EU877381
115 NCPGR215 (CA)3N4(CA)5tt(CA)4 GTAGCGTGATGTCCTTTCTC/GGCGACAACAGATACTCTTC 54.5 195 1 EU877382
116 NCPGR216 (CA)11tc(TA)3 GAGCAAGTGTAAACTAGCAAACT/AGCGGATAACAATTTCACAC 55.4 286 1 EU877383
117 NCPGR217 (TG)15 GACTACTTGGAATACGTCGC/CGCGCAGTGATTTAAGCTAT 55.1 171 1 EU877384
118 NCPGR218 (AT)5(GT)11 TTGCTTCGACACTGTAACAC/GCGTGGACTAACTCTTTTCA 54.5 275 1 EU877385
119 NCPGR219 (CA)13(TA)3 ATGTGACCAAAGTAAGGGTG/ATAAGTGTAGGGTGTCTCAA 54.5 237 1 EU877386
120 NCPGR220 (GT)13(GA)4 ACTTCTCTACTCAGCCCCTT/GCCCCTATCTTTCAGACTTT 54.5 255 1 EU877387
121 NCPGR221 (CA)3cga(CA)cg(CA)7(TA)4 CATATGCATCATCTCAACCA/TGTCCTTCGTCTTGTTCTTC 55.0 260 1 EU877388
122 NCPGR222 (CT)22 TGGTCTTGATTCTTGTCTGG/GAGCAACAAAGCCACAAATA 56.6 165 1 EU877389
123 NCPGR223 (CA)16(TA)6 TGGGTTTCTTTTCTTGAAGC/AGTGGGTTGAGAAATTACGG 56.5 267 1 EU877390
124 NCPGR224 (AT)6(GT)14 TGGAATTAGTTGATGTGACAA/ATTTCCCGTGTCTTTGAGAT 54.7 225 1 EU877391
125 NCPGR225 (CA)3a(CA)12(TA)3 TCCGTAACAGTGATGAACAA/TGGGATTACACTGGATAAGG 55.2 203 1 EU877392
126 NCPGR226 (CT)17 GACTGCATGTTTTCTTCTCG/ACCACTTCAAAGCCTATTCA 55.3 205 1 EU877393
127 NCPGR227 (CA)5N10(CA)24(TA)4 CATTTACCCTCACTTCCGTCA/TGGTTCAGACATCACACCAAA 59.9 207 1 EU877394
128 NCPGR228 (CT)8N10(CT)17 CAACGGTTAAGAATGTGCAA/GCGTGGACTACTCATGTGTCT 57.0 236 3 EU877395
129 NCPGR229 (GA)3ta(GA)15 CAAATTTTGCGCTGTTGTAG/ACACCTCATCTCCCTTTGAA 57.9 158 1 EU877396
130 NCPGR230 (GA)26 CCTCGATTTAAGAGGAACTCA/TGTGTGAAAACACTTTGACTGA 56.7 242 1 EU877397
131 NCPGR231 (GA)42 AACCTCCGTCCACACATTTC/GGTCGAAGCCATTGTTTTGT 59.4 226 1 EU877398
132 NCPGR232 (GA)34 GGACCGAATGTCCATAAATC/TCTTTTAGGACCCAATGGAG 56.5 265 1 EU877399
133 NCPGR233 (CA)17(TA)5 GTTTTTGCGAGGCAGTAAGG/TGAAAGGTGATGTGGAAACG 59.5 243 1 EU877400
134 NCPGR234 (GA)26 TTAAAAATTCAGGGGGCTCA/CCCCTAGTAGCAAATATTTTGACC 59.5 188 1 EU877401
135 NCPGR235 (CA)40 GACTAACCGCGATCAACACA/TGGTTTGAGAGGTGATGTGG 59.7 182 1 EU877402
136 NCPGR236 (GT)12(GA)25 CAACGGTAACATTCTCAACG/TTTTCTTTTGATGTGTTCTTGG 56.5 200 2 EU877403
137 NCPGR237 (GA)2ta(GA)24 ATTGCTCAGCTTTTGGAGGA/CGGGCTGGGAATTAAATAGA 59.9 314 1 EU877404
138 NCPGR238 (GA)3a(GA)18 GTCCGTGACATTGACACTTT/CATAGTTGGATTGCCTCTCA 56.5 273 2 EU877405
139 NCPGR239 (CA)4N12(CA)5cc(CA)8ga(CA)5 TGATGAAGGTTGTAAACATGG/GGTGGTTTATGCCACAATAA 56.5 137 1 EU877406
140 NCPGR240 (GA)17 AAGGGGTGAGTTTTTGAGTT/CCCCTTAATTTCTTTCTCCA 55.0 238 1 EU877407
141 NCPGR241 (TA)5(TG)15 GCGTTTTCCAGAGAAATTCA/GGGAGGAAACATTTTCGTTT 58.7 250 1 EU877408
142 NCPGR242 (CT)11(CA)12 TCGTCATATCCACCCGATAA/TGGATAATGGTGCGAAAGAA 58.5 145 1 EU877409
143 NCPGR243 (CA)13 TGCTTGGGCGAGAGTAGTTA/GCGGCGTTTAGTTTCTTCAA 58.7 206 1 EU877410
144 NCPGR244 (CT)2c(CA)11 TGGACTACTGAATCACTCCCTCT/TGCTAAGTTGTCTGGGTGGA 59.2 200 1 EU877411
145 NCPGR245 (CA)13 GTTTGACTAAATATGGGGCA/AAGGATGAGTCATGGAAAAA 54.5 148 1 EU877412
146 NCPGR246 (CA)13 GTGGACTAACCCACATAGGA/ACCATTACCAGAAACCATGA 54.5 154 1 EU877413
147 NCPGR247 (GT)12 CAATGATTGGTTCTCTCCTC/GGTTTGACTAAAATATGGCG 54.5 105 1 EU877414
148 NCPGR248 (GT)12 GGCATTGTATGGAAGGAGGA/CGCGTGGACTACCATATCATT 59.8 230 1 EU877415
149 NCPGR249 (CA)5a(CG)3(CA)10 CTCTTCGATTCGGATAGGTT/TGTTTTCAGCTAAATTTCACG 55.5 231 1 EU877416
150 NCPGR250 (CA)10 CGCGTGGACTAACTTCTGTA/TGGCCTAACAGCTTTCCATT 57.9 243 1 EU877417
151 NCPGR251 (CA)13 AATGGGTTAATTTGACTTGC/TTAATGGCCACCATAATCTT 54.0 282 1 EU877418
152 NCPGR252 (CA)12 TTGCCCTGAGGAATACATTA/GGTTGTTGAAGGCATAACTG 54.3 187 1 EU877419
153 NCPGR253 (GT)12N21(GT)21 ACATTGGTGGCAACTCCATT/GGCGTGGACTAACATCCAATA 60.0 236 1 EU877420
154 NCPGR254 (AT)2(GT)11 GCCTTTTTCAATTTCTCTCA/CCCAAAGAAGACAAAACAAC 54.5 298 1 EU877421
155 NCPGR255 (GT)12 TCAGTGGTATTGAGACATCG/CCATCTTCAAAAGTGAACCT 54.0 258 2 EU877422
156 NCPGR256 (CA)12 AATGGGTTAATTTGACTTGC/TTAATGGCCACCATAATCTT 54.2 280 1 EU877423
157 NCPGR257 (GT)5gc(GT)4 CCAAAGGTGCGATGAAAATC/GCGTGGACTACTCTTCATGT 58.2 182 1 EU877424
158 NCPGR258 (CT)7atca(CT)4 TTTTACCAATGACTGGCTGA/TTGTGGTGAAGAATCTGAAGAG 56.5 250 1 EU877425
159 NCPGR259 (GT)12 TATAGCCATAAGGGCAACAT/TGTGGTAGAATGGGGAATAG 55.6 185 1 EU877426
160 NCPGR260 (GT)12 CGGCGTTTAGTTTCTTCAAT/ATTAAGTTGGGTAACGCCAG 56.5 247 1 EU877427
161 NCPGR261 (CA)2t(GT)12 GATTGTGTGGCAAAATCCAT/ACTCTCAGGTTGCTGTTCTGA 58.9 300 1 EU877428
162 NCPGR262 (GT)13 GATAAGCGATAACCTTGTGG/CGCGTGGACTAACATATCAT 55.0 185 1 EU877429
163 NCPGR263 (GT)10 CAAGGATGAATGTGTGTGTG/CATAGTATCCTCGGTTTCCC 55.5 111 2 EU877430
164 NCPGR264 (GT)3gg(GT)5gg(GT)2 TGGGAATCTTGTTGGTTCTT/TGAAAGGAGATGGAAAAAGC 57.1 221 1 EU877431
165 NCPGR265 (GT)11(CT)2 GTGTTTGTTGCTCTGTCTGA/CACCCACACACATACACAGT 54.5 195 1 EU877432
166 NCPGR266 (CA)12 TGTGAAAACTGATGAGGACA/GTGTGTTGTCGTTTGTCTTG 54.5 195 1 EU877433
167 NCPGR267 (TA)2(CA)13 ATTAACTGTGCTGGAGGAAA/TATAGCCATAAGGGCAACAT 54.5 279 1 EU877434
168 NCPGR268 (GT)11 TCAACTAAGGATTTGCTCG/AGAGCTGAGAGAGTGGACAA 54.5 296 1 EU877435
169 NCPGR269 (GT)9 CGTGGAACTATCGAAAGGTGT/ATAAGCCAAGGGAGGACGAA 60.5 221 1 EU877436
170 NCPGR270 (GTATGTAT)2(GT)10 GTTTGTAAGAACTGAAAAGTTGTGC/CGTGGACTAACCCACATAGGAAT 60.0 236 1 EU877437
171 NCPGR271 (CA)13 TGGAATTAGTTGATGTGACAATGA/CGGAGGGTGAGAAGCAGT 59.1 355 1 EU877438
172 NCPGR272 (AT)4(GT)13 TGGACTAACAGCTTTCCATT/GTCTTCTGTAGATTGAAGTTGTAAA 54.5 233 1 EU877439
173 NCPGR273 (CA)11 CCATCTTCAAAAGTGAACCT/TCAGTGGTATTGAGACATCG 54.6 273 1 EU877440
174 NCPGR274 (GT)12 GTGTGTTGTCGTTTGTCTTG/TTTTGAAGAGCAATCAATCC 55.9 268 1 EU877441
175 NCPGR275 (CA)7(TA)5 CGAGGAAGCATTCTGCATT/TCCTGGAGCCTCGATTAAA 58.0 355 1 EU877442
176 NCPGR276 (CA)a(CA)9 CTGCAAAATCGAAGGGAGGT/GCATGCGTCTTTCTCTCTTT 56.9 257 1 EU877443
177 NCPGR277 (CT)17 CAGCTACTCCATTATTTTGTGTTT/CACATGAAGTCGTCCAACAA 56.5 278 1 EU877444
178 NCPGR278 (GT)5g(GT)3gc(GT)2 TGAGACATCGACTATTGGACA/GACCATCTTCAAAAGTGAACC 56.0 250 1 EU877445
179 NCPGR279 (CT)17cctt(CT)2 TTTGAGGTCTTACTCTTTACAGC/ATTAAACGTGAGGGAGAAAA 54.5 248 1 EU877446
180 NCPGR280 (GT)13 GCAATGATTGGTTCTCTCCTT/TTTGGGTTTTCTAGCTCCTT 56.5 207 1 EU877447
181 NCPGR281 (GT)9 GCAATGATTGGTTCTCTCCT/GTGGAATTCTTTAGGGTTTGAC 56.5 114 2 EU877448