Skip to main content

Table 8 Primers for the real-time RT-PCR experiment. Sequences of the forward and reverse primers of the differentially expressed and housekeeping genes for the real-time RT-PCR experiment.

From: Mesenteric lymph node transcriptome profiles in BALB/c mice sensitized to three common food allergens

Accession ID Gene Symbol Direction Primer Sequence
House Keeping Gene
Mm.180458 Rpl13a Forward 5' GAGAAACGGAAGGAAAAGGCC
Mm.180458 Rpl13a Reverse 5' GCAGGCATGAGGCAAACAGT
Differentially Expressed Genes
Mm.127058 Stard4 Forward 5' GAGTGGCGAGTTGCCAAAAA
Mm.127058 Stard4 Reverse 5' CCACGTCATCCATAACTCCTTGA
Mm.1192 Igj Forward 5' TCATCCCTTCCACCGAGGA
Mm.1192 Igj Reverse 5' CCAGCTCCACTTCCACAGGA
Mm.8245 Timp1 Forward 5' AAATGCCGCAGATATCCGGT
Mm.8245 Timp1 Reverse 5' CTGATGTGCAAATTTCCGTTCC
Mm.1355 Cd79a Forward 5' ACAGGCCAGCTGTTCTTCCC
Mm.1355 Cd79a Reverse 5' GCTGTGATGATGCGGTTCTTG
Mm.263396 Itgb1 Forward 5' CCAGTCCCAAGTGCCATGAG
Mm.263396 Itgb1 Reverse 5' GCAGTAAGCGTCCATGTCTTCAC
Mm.286622 Pex13 Forward 5' GTGGCCTGCCTTAGTGCTGA
Mm.286622 Pex13 Reverse 5' CGTGGTCATCCTCACCACTTG
Mm.233846 Syt4 Forward 5' CTTATCCCCACATCCAAGAGCTC
Mm.233846 Syt4 Reverse 5' AGACCAGAAGTTCACCCCGG