Skip to main content

Table 2 Sequences of primers used in this study

From: Identification, variation and transcription of pneumococcal repeat sequences

Primer Name Primer Sequence (5'-3')
05060_PL TCAAACCACGTCAGCTTCAC
05060_PR CTTGTCCACCACTTCTGCAA
05060_PS TAAAATCATTTTATACTCTTCGAAAATCTC
16220_PL ACCTGATAAAATTTCAGTAAAATGC
16220_PR TGTAAACGAGTAAAAGCGAAT
17630_PL GAAGCCAAAACCTTCATCCA
17630_PR CAGGCTGCTCAAAACACG
17630_PS TTCACCTTTTGTGGATTGGTC
21390_PL TGTTCATATTCTAGGAAGATTTGTTGA
21390_PR GCAGGTTGCTCAAAACACTG
21390_PS TCCATAATATCTATAGTGGATTTACCC
Tbox_PL AATCTGCAATCGCAGCTAGG
Tbox_PR CGTTACCAACGCCCTCAC