Skip to main content

Table 6 Candidates for novel barley miRNAs not previously described in rice, Brachypodium or wheat.

From: Discovery of barley miRNAs through deep sequencing of short reads

Read name Proposed miRBase name Read sequence Read Length Abundance putative miRNA* name putative miRNA* sequence putative miRNA* Length putative miRNA* abundance Confidence
GPB235   AUAAAACCUUCAGCUAUCC AUC 22 4601 GPB7393 UUUGAUAUGUAAGUGGAUAGUU 22 431 ***
GPB125 miR5048 UAUUUGCAGGUUUUAGGU CUAA 22 12068 GPB971 AGACCUAGACAUGCAAGUAUA 21 1201 ***
GPB1131 miR5049 UCCUAAAUACUUGUUGUU GGG 21 803 GPB31055 AACAACAAGUAUUAUGGUACA 21 16 ***
P51WP1692 miR408b CAGGGAUGGAGCAGAGCAAGG 21 225 P51WP9508 UGCACUGCCUCUUCCCUGGC 20 48 ***
GPB8582 miR5050 UUGAGGUCGUUCAACCAGCAA 21 78 P45NP15695 CAGCACUAGCAAGUUGGUCGACCU 24 34 ***
GPB86 miR5071 UCAAGCAUCAUAUCAUGGACC 21 19176      **
GPA5819 miR5072 CGUUCCCCAGCGGAGUCGCCA 21 147      **
GPB2903 miR5054 UCCCCACGGACGGCGCCA 18 352      **
GPA3884 miR5055 UCUCGCUACUGAGCUCGGCAU 21 157      **
P45NP9164 miR5056 AGGAAGAACCGGUAAUAAGCA 21 72      **
P45NP15764 miR5073 GUUUGGUGAAUCGGAAACAAUUU 23 28      **
GPB4154 miR5057 AAAUUUCAGAUCAUUUGGACA 21 178      **
TF6215B7984 miR5058 AAUAGUUGAGGGAUGGAAAACA 22 68      **
TF6215B74145 miR5086 ACAUUGGUGGAAGGCGUGGUA 21 20      **
TF6215B6553 miR5074 GAAGGCCACCGUCGGCACCGC 21 142      **
P51WP57134 miR5059 CGUGCCUGGGCAGCACCACCA 21 16      **
P51WP4847 miR5075 UUCUCCGUCGACGCCAUCCGC 21 205      **
P51WP10727 miR5060 CGGCAAGCUAGAGACCGCCAC 21 68      **
P45NP51144 miR5061 UCUGUUCUGUUCUGAUCGGUA 21 24      **
P45NP40836 miR5051 UUUGGCACCUUGAAACUGGGA 21 21      **
P45NP31207 miR5076 UAAAUGGGAGCAGAGCAGGUUU 22 16      **
P45NP21816   UGAGCUACAAAAGGAUUCGUU 21 25      **
P45NP16270 miR1878 AUUUGUAGUGUUCGGAUUGAGUUU 24 33      **
GPB49459 miR5084 AUACAGUACUGCAGAGGAUCCUAA 24 16      **
GPB41819 miR5085 AAGGACAUUUUUUGUGGCAUG 21 47      **
GPB2977 miR5062a UGAACCUUGGGGAAAAGCCGCAU 23 99      **
GPB5902 miR5062b UGAACCUUAGGGAACAGCCGCAU 23 57      **
GPB16764 miR5063 UCCACUGGAAGAGGCUUUUGCU 22 54      **
P51WP18432 miR5052 ACCGGCUGGACGGUAGGCAUA 21 36      *
GPB1614 miR5064 UGAAUUUGUCCAUAGCAUCAG 21 513      *
GPB25359 miR5065 UAGGCAAUUCACAUAUACACU 21 27      *
GPB17570 miR5066 AAGUGUAUAUGUGGAUUGCCU 21 73      *
GPB26526 miR5053 CGCAGCUGUAGUCGCCGGCGU 21 22      *
GPB320 miR5077 GUUUCACGUCGGGUUCACCA 20 5056      *
P45NP187203 miR5078 GGUCGUUCGACCGCGGCAUUU 21 25      *
GPB373 miR5067 UGAGCGACAAGUAAUAUGGAU 21 4043      *
P45NP20958 miR5068 AUCAGGUAGAUCGGGUAUGGGUAU 24 40      *
P45NP15484 miR5079 UUUGGAUUUGUUAUUUUGGUAU 22 68      *
GPB9781 miR5080 AAAAAGAUCAUACCGUGAGAG 21 88      *
GPB37150 miR5069 UAGGUGAUUGAUUUGACUAAC 21 17      *
GPA47901 miR5081 UAAUUUGUAGCAAAUUGGUGU 21 16      *
GPA42571 miR5082 CGCGAUGAUGGCCGCGCGGGCUCA 24 17      *
GPA18850 miR5083 AGACUACAAUUAUCUGAUCA 20 28      *
GPA14470 miR5070 AACUAAGUAUGGUCGGAGGGU 21 49      *