Table 4 List of grain quality genes with similar expression patterns in both SBS and MPSS libraries and up-regulated over five fold in Cypress (in comparison to LaGrue and Nipponbare) and in Ilpumbyeo (in comparison to YR15965 and Nipponbare)
Up-regulated in Cypress | Family | TIGR Gene ID | TIGR gene name | MPSS signature | SBS signature | MPSS Ratio PSC/PSL | MPSS Ratio PSC/PSN | SBS Ratio PSC01/PSL01 | SBS Ratio PSC01/PLN02 |
|---|---|---|---|---|---|---|---|---|---|
| Â | Starch synthesis and degradation | Os04g08270 | Limit dextrinase, putative, expressed or alpha-amylase | GATCAGATACTCCTCAC | GATCAAATCTGAACCCATCA | 49 | 16.3 | 8 | 8 |
| Â | Starch degradation | Os09g29404 | Alpha-amylase activity | GATCTCCTCCTTTTCCT | GATCTGGAAGCGCGCCATTG | 25 | 25 | 5 | 5 |
| Â | Glutelin | Os02g15070 | Glutelin type-B 7 precursor | GATCCATTGCACAAGAG | GATCCAGCCACAAACCAATG | 22 | 11 | 8 | 8 |
| Â | Starch synthesis and degradation | Os06g51084 | 1,4-alpha-glucan branching enzyme, chloroplast precursor | GATCAAGCAATGAATGC | GATCAACCCATGCTCCACCC | 24 | 24 | 19 | 19 |
| Â | Seed specific | Os03g58480 | Seed specific protein Bn15D14A | GATCACATCGTCACAGC | GATCTAGAATCTCCAGAGGG | 14 | 28 | 7 | 7 |
| Â | Starch degradation | Os02g32660 | Expressed 1,4-alpha-glucan branching enzyme | GATCATGACTTTCAGCA | GATCACAGAAGACACACTTC | 6 | 24 | 8 | 8 |
| Â | Aspartate biosynthesis and degradation II + asparagine biosynthesis I and degradation I | Os02g14110 | Nitrogen compound metabolism | GATCTGTGAATTTGGCA | GATCCAGAGAGAGATGCTAA | 66 | 66 | 8 | 8 |
| Â | Globulin | Os03g46100 | Globulin-1 S allele precursor | GATCATCCGCGCGTCGG | GATCGTTTAGTTGGGAGTGG | 20 | 20 | 8 | 8 |
| Â | Seed maturation | Os09g10620 | seed maturation protein LEA 4 | GATCGAGTTGAGTGTGT | GATCGACTTGTGTGAGTTGT | 16 | 16 | 8 | 8 |
Up regulated in Ilpumbyeo | Family | TIGR Gene ID | TIGR gene name | MPSS signature | SBS signature | MPSS Ratio PSI/PSY | MPSS Ratio PSI/PSN | SBS Ratio PSI02/PSY02 | SBS Ratio PSI02/PSN02 |
| Â | Methionine degradation I | Os01g22010 | Methionine adenosyltransferase | GATCCCGACTTCACATG | GATCCTCGCGGCCGAAATGG | 35 | 35 | 14 | 14 |
| Â | Isoleucine biosynthesis I | Os03g21080 | Acetolactate synthase | GATCGGAGCCTAGTTGC | GATCCAGCACACATTCAAAA | 5 | 5 | 10 | 10 |
| Â | Starch synthesis | Os06g12450 | Soluble starch synthase 2-3, chloroplast precursor | GATCTGGAAGTGAAATA | GATCTGGAAGTGAAATATTT | 12 | 12 | 20 | 20 |
| Â | Seed allergenic/lectin | Os07g11510 | Seed allergenic protein RA5 precursor | GATCGCCTCGCACCTGC | GATCACTTTAGTCTTTATAG | 15 | 15 | 24 | 24 |
| Â | Starch degradation | Os02g32660 | Expressed 1,4-alpha-glucan branching enzyme | GATCAGTGTTTTAAGTT | GATCAAATTACATATTGCTG | 24.5 | 49 | 56 | 56 |
| Â | Starch synthesis | Os06g04200 | Granule-bound starch synthase 1, chloroplast precursor | GATCTTCCACAGCAACA | GATCTTGGCAAGTCAATTAA | 6 | 6 | 14 | 14 |
| Â | Isoleucine degradation I | Os02g43720 | Enoyl-coA hydratase | GATCGTCTTGAAGGTCT | GATCTACCTCCATGCCTTGA | 6.2 | 25 | 15 | 15 |
| Â | Aspartate biosynthesis and degradation II + asparagine biosynthesis I and degradation I | Os01g55540 | Aspartate transaminase | GATCAAGTGGCTTTCAT | GATCGGCAAATACTCCTTAA | 34 | 34 | 32 | 32 |