Skip to main content

Table 4 List of grain quality genes with similar expression patterns in both SBS and MPSS libraries and up-regulated over five fold in Cypress (in comparison to LaGrue and Nipponbare) and in Ilpumbyeo (in comparison to YR15965 and Nipponbare)

From: Deep sequencing reveals the complex and coordinated transcriptional regulation of genes related to grain quality in rice cultivars

Up-regulated in Cypress Family TIGR Gene ID TIGR gene name MPSS signature SBS signature MPSS Ratio PSC/PSL MPSS Ratio PSC/PSN SBS Ratio PSC01/PSL01 SBS Ratio PSC01/PLN02
  Starch synthesis and degradation Os04g08270 Limit dextrinase, putative, expressed or alpha-amylase GATCAGATACTCCTCAC GATCAAATCTGAACCCATCA 49 16.3 8 8
  Starch degradation Os09g29404 Alpha-amylase activity GATCTCCTCCTTTTCCT GATCTGGAAGCGCGCCATTG 25 25 5 5
  Glutelin Os02g15070 Glutelin type-B 7 precursor GATCCATTGCACAAGAG GATCCAGCCACAAACCAATG 22 11 8 8
  Starch synthesis and degradation Os06g51084 1,4-alpha-glucan branching enzyme, chloroplast precursor GATCAAGCAATGAATGC GATCAACCCATGCTCCACCC 24 24 19 19
  Seed specific Os03g58480 Seed specific protein Bn15D14A GATCACATCGTCACAGC GATCTAGAATCTCCAGAGGG 14 28 7 7
  Starch degradation Os02g32660 Expressed 1,4-alpha-glucan branching enzyme GATCATGACTTTCAGCA GATCACAGAAGACACACTTC 6 24 8 8
  Aspartate biosynthesis and degradation II + asparagine biosynthesis I and degradation I Os02g14110 Nitrogen compound metabolism GATCTGTGAATTTGGCA GATCCAGAGAGAGATGCTAA 66 66 8 8
  Globulin Os03g46100 Globulin-1 S allele precursor GATCATCCGCGCGTCGG GATCGTTTAGTTGGGAGTGG 20 20 8 8
  Seed maturation Os09g10620 seed maturation protein LEA 4 GATCGAGTTGAGTGTGT GATCGACTTGTGTGAGTTGT 16 16 8 8
Up regulated in Ilpumbyeo Family TIGR Gene ID TIGR gene name MPSS signature SBS signature MPSS Ratio PSI/PSY MPSS Ratio PSI/PSN SBS Ratio PSI02/PSY02 SBS Ratio PSI02/PSN02
  Methionine degradation I Os01g22010 Methionine adenosyltransferase GATCCCGACTTCACATG GATCCTCGCGGCCGAAATGG 35 35 14 14
  Isoleucine biosynthesis I Os03g21080 Acetolactate synthase GATCGGAGCCTAGTTGC GATCCAGCACACATTCAAAA 5 5 10 10
  Starch synthesis Os06g12450 Soluble starch synthase 2-3, chloroplast precursor GATCTGGAAGTGAAATA GATCTGGAAGTGAAATATTT 12 12 20 20
  Seed allergenic/lectin Os07g11510 Seed allergenic protein RA5 precursor GATCGCCTCGCACCTGC GATCACTTTAGTCTTTATAG 15 15 24 24
  Starch degradation Os02g32660 Expressed 1,4-alpha-glucan branching enzyme GATCAGTGTTTTAAGTT GATCAAATTACATATTGCTG 24.5 49 56 56
  Starch synthesis Os06g04200 Granule-bound starch synthase 1, chloroplast precursor GATCTTCCACAGCAACA GATCTTGGCAAGTCAATTAA 6 6 14 14
  Isoleucine degradation I Os02g43720 Enoyl-coA hydratase GATCGTCTTGAAGGTCT GATCTACCTCCATGCCTTGA 6.2 25 15 15
  Aspartate biosynthesis and degradation II + asparagine biosynthesis I and degradation I Os01g55540 Aspartate transaminase GATCAAGTGGCTTTCAT GATCGGCAAATACTCCTTAA 34 34 32 32