Skip to main content

Table 2 Primers used for assay design.

From: A systematic evaluation of expression of HERV-W elements; influence of genomic context, viral structure and orientation

Target LTR status Polarity Sequence Position Target Polarity Sequence Position
Intronic HERV-W proviral element (3' region)   Gene harboring provirus
Sense         
CD72 intron 1 3' F TGTCTCCAATTTTAACCCTATTTGC chr9:35629741 CD72 exon 1~2 F CTCTAGCTGATCGACTCACAAATACC AK311283
   R TTCCCCAGCCAGCATGTAA chr9:35629792   R TGAACATTCTCGTAGGTGATTTCC  
TBX18 intron 7 5'&3' F CCATTCCATGTTCCTCATTAAATCT chr6:85477157 TBX18 exon 7~8 F CCCAAGCAAGAATACAGGGACTT BC040697
   R AGGCAATCTTACCACCCAGAAG chr6:85477208   R GGTTTCCCTTGAGACCAAATTG  
Antisense         
ACOX3 intron 1 5'&3' F AGACGCTTGGAGCAGTTTCTG chr4:8480630 ACOX3 exon 1~2 F CTGTGGAGTGTGTGGGCTCTT AK225080
   R TCGGAGGACTTTACACATTGAACTAG chr4:8480744   R CAGAGCTGTGTCGCCTCCTT  
KYNU intron 2 5'&3' F AGTGGGAATACTGACGCTCTTACC chr2:143372701 KYNU exon 2~3 F ACAGGATCTGCCTCCAGTTGA U57721
   R GCCAAGAACCCAAGGTCAGA chr2:143372792   R TGGCCCACTTATCTAGTTCTTCTTC  
THEM2 intron 1 5' F TGAGATACCAGAGATCACCAAACTCTT chr6:24787905 THEM2 exon 1~2 F GGGAGGTGATAAAGGCCATGA BC000894
   R TGAAGTTTTATAAGGGTTAGGACAATCTT chr6:24788017   R GGAGCAGCAGAGACAAGAGTAATCT  
ZNF678 intron 1 5'&3' F GGAAATGAACATAGTCTTACTGTCAGGTA chr1:225878139 ZNF678 exon 1~2 F TGCAGGTACTGGGAGTTACATAGC BC042500
   R CATAGAGTCCAGAAATGTGTCTATCCA chr1:225878254   R TGCCAGTAGTCCCGTTTTCC  
ANO3 intron 14 3' F AAAGGATTGTGTAAGAGAAGCTGATAAGA chr11:26568090 ANO3 exon 14~15 F TTGTTCGATAATGGAGGGACAGT BC172396
   R GCAGAGATGTTATCCCTGTTGGT chr11:26568167   R CGATAAGGTCCCAAGTATAGGTCAGT  
Intronic HERV-W proviral element (5' region)
CD72 intron 1   F GCAGAGGTCTACTCACACCATAGC chr9:35633414     
   R GGCAATCAGGAGGCCTAAA chr9:35633462     
TBX18 intron 7   F GGGCTACAGTGATCCATTTATAAGG chr6:85488459     
   R AAACTTTATCCAAACATTCCCTATGTTAG chr6:85488532     
ANO3 intron 14   F TCTCCTTCACCACGAGAGTTTG chr11:26576040     
   R TGCTACTCGTCCAGAGCTTACAGA chr11:26576091     
Intronic HERV-W pseudoelement (3' region)   Gene harboring pseudoelement
Sense         
SLC16A10 intron 1   F TGGCAGTGCTCGTTGAATGT chr6:111566680 SLC16A10 exon 1~2 F GGCTCCAAAGACGATGACAAG BC034031
   R ACATAAGCCCCAAAACTGTCAGA chr6:111566728   R AAATCATCCCCATGGAGAGAGA  
AK024261 intron 1   F GGCCCACCTCCAGCAAA chr2:218160716 AK024261 exon 1~2 F CAGCAGATGATGGTGATGGAA AK024261
   R TGGGTGTGATCAGGTCATGGT chr2:218160778   R CATCCCTCGGACTCAGTTTCTC  
Antisense         
FOXP2 intron 3   F CAAGAGGACATCTCTAAATCAAAGACTGT chr7:113805180 FOXP2 exon 3~4 F GCGAGGTTAATTCGAAAGTCTTGTGGAA AF454830
   R GAGCATGCCAGGCAAAGC chr7:113805235   R TTGCTTATTGTCTCTGTCGCAGAT  
APG5 intron 6   F TCAAATCACACAATGCTCCAATG chr6:106791850 APG5 exon 6~7 F ATCCCCTTTAGAATATATCAGACAACGA BC093011
   R TTAGCAGTTGCATATGAGATCTTTCA chr6:106791905   R CCTAGTGTGTGCAACTGTCCATCT  
KIAA0423 intron7   F GACATGAATATTTTTTGTGGACATAACTC chr14:44557550 KIAA0423 exon 7~8 F CCAACAAGACTTTCTTCTGCAAAG AB007883
   R GCCAAACAGAACAGTACTAAACTATATTATAGACT chr14:44557636   R TTTGCTGTGGATTTGATGATGAC  
NRCAM intron 2   F AAGTCTGGGTTCCAGGTTCATC chr7:107772873 NRCAM exon 2~3 F GCTGGTCTTAGCTGTTGGCATT BC115736
   R CTGAGGAACCTTTCTGAGTTGAGTAA chr7:107772929   R CGTCTTCTTAGCATTGCTCTTCAG  
ZMAT3 intron 2   F GGATTCCCAGGTACGGTGAAA chr3:180258291 ZMAT3 exon 2~3 F CTCTGCAATGTCACCTTGAACTCT BC002896
   R CCTAGAAAGCTACTTCCGCTTCAG chr3:180258381   R GCTGCATAGTAATTTCGGAGTTTCT  
Intronic HERV-W pseudoelement (5' region)
SLC16A10 intron 1   F CAAGAGGACATCTCTAAATCAAAGACTGT chr6:111558508     
   R GAGCATGCCAGGCAAAGC chr6:111558555     
FOXP2 intron 3   F TCAAATCACACAATGCTCCAATG chr7:113813845     
   R TTAGCAGTTGCATATGAGATCTTTCA chr7:113813901     
NRCAM intron 2   F GACATGAATATTTTTTGTGGACATAACTC chr7:107763923     
   R GCCAAACAGAACAGTACTAAACTATATTATAGACT chr7:107763973     
Intronic solitary LTR   Gene harboring solitary LTR
Sense         
ZNF 277 intron 1   F AGAACCCAGGTCAGAAAACAAGAG chr7:111648615 ZNF277 exon 1~2 F GGCTGTCGCCCGAATG AF209198
   R CAGTCCCTGGTGCCAAGAAG chr7:111648735   R ACAATCCTTACTGTCCCCATAACC  
WDR72 intron 14   F AAACACTATCTGATTGCCTGACAGA chr15:51704774 WDR72 exon 14~15 F CCAGCTTGGGCCATTACCTT BX53788
   R CCAGGACCTTGTCTATGATGCA chr15:51704828   R GCAAAATTTGGCATCAGTAACCT  
chrXq13.1   F CAGGTCCATTTAAAGCCCAAGT chrX:71350691 PIN4 exon 3~4 F CAGGTCCATTTAAAGCCCAAGT AK12760
   R CCTGAAAGTGAAGCCAAAAGGA chrX:71350741   R CCTGAAAGTGAAGCCAAAAGGA  
chrXq26.2   F TGGGAGAAGCAATGTCCAATT chrX:131380909 MBNL3 exon 1~2 F TGGCCTGTTTTGATTCTCTAAAGG AB077698
   R TTTGTCAAGTCATGGCCGTTT chrX:131380961   R AGTGTGGAGGAGGGTGAAGGT  
Antisense         
C9orf85 intron 2   F ACCCACCAATTCCGGATACA chr9:73769452 C9orf85 exon 2~3 F GAGTGGCGTGTAAAATACAGCAAA BC052375
   R TGGCCCAAGATTTCATTCCT chr9:73769523   R CATGGCCTGCACATTATGTGA  
      UBD exon 1~2 F GATGGCTCCCAATGCTTCCT AF123050
       R TGGCATCAAAGGTCATTAAATCC  
chr6p22.1   F GCCAGATAACCAGCTTCTCTTCA chr6:29635237 GABBR1 exon 18~19 F GGAGTCGAGTGCATTTGCTTTAT BC051463
   R GAGAAGAGGCTGGCATTGACA chr6:29635286   R TGGCATCAAAGGTCATTAAATCC  
chrXq13.1      ERCC6L exon 1~2 F GGAAGCCGAGGCCTTGAG BC111486
       R TTAGTTGCTTCTTTGGCCTCTTTC  
chrXq26.2      AK095439 exon 2~3 F ACTTCATTGAATGTCTTAGACGGAAA AK09543
       R TCACATATGCAGTTATCAAAAGAGCTT  
Intergenic HERV-W proviral element and adjacent genes   Intergenic HERV-W pseudoelement and adjacent genes
LRIG3 (5')   F TCGAGTAATTCTTTCATGGGTACCT AY505340 COBLL1 (5') F CAGAGTTTGCTGACTGCAATCC BC071588
   R ATCTGATGGCTGTCCAAAGCTT    R GACCTTCCATTCACAGATATTGTATTTG  
pro chr12q14,1   F TGGTCAAGAGGAGTCCAGAGTTT chr12:57530852 pse chr2q24,3 F ACCTACACCAATTCAGCTGTTAAGG chr2:165222305
   R GCCCACCAATGCAATGCT chr12:57530902   R CCACAATGCTCCGAGTTCACT chr2:165222360
AK093124 (3')   F TGTCCCTTGCTACATACCTGCTT   GRB14 (3') F TGTGCTGCAGACAGGCGAAAA  
   R TGCACTCAGATAAAGTGTCAATAAGAAG AK093124   R CAGATGTAAATGGAGAACAGCATAGC BC053559
GSTA4    N/A   GRK7 (5') F TGCAGGCTCTTCTTGGCTAAG AF439409
       R GTTTCCTGGGATCATCAGAATTTT  
pro chr6p12,1   F GACCTTTTTCCTGGGCATCA chr6:52887125 pse chr3q23 F GGGTCCAAGGCTGCTCCTA chr3:143023903
   R GGGTAGGTGAACATGCCAGAA chr6:52887169   R GGTAAGCCTCCTGCACTCTGA chr3:143023960
GSTA3 (3')   F GCGGAGACCGGCTAGACTTT   ATP1B3   N/A  
   R CCGTCCATTGAAGTAGTGAAGCT BC020619     
AKR1B10 (5')   F TGCTGAGGAGATGGCAACCAT B C008837 CLSTN3 (5') F GGGATGACTCAGCTCTCACCAT BC039075
   R TCCAAATGAGAGGATTGCAACAC    R TCACACAGGACTGCCGATTC  
pro chr7q33   F TGGAAGAAACAAATTGCCTGATC chr7:133929406 pse chr12p13.31 F CAGAAAGGTTTTGCCTAGTAGTGTTG chr12:7230506
   R AAATGCCCTTAGGCCAGATAGAT chr7:133929455   R TGTGCTGTACTTCTGCTTTTTAGAAAT chr12:7230605
BPGM (3')   F GGTGGCCCCTTTGCAGAT   PEX5 (3') F ATGCAGCAGATTGAGCAGTCA  
   R TGGACATACTGATGGCTGAACTTC BC01705   R CAGTTCTCAGACAAGGCCAAGTC AK301700
TMEM26 (5')   F TGCCATCCTTGTTATATGGACTTG CR749606 INTS7 (5') F CACTGCAGAGTAAATCTGGACAAGA BC020523
   R CAGGGCACACAACGTTCTGT    R TCAACCCTTTGCTCCATCTCA  
pro chr10q21.2   F TGAAACGTGTCATGTATCATCTCAA chr10:62462501 pse chr1q32.3 F TCTGATGAACTCTGAATAAACTCTTTCT chr1:210095554
   R GGTAACACCCGGCCATTTT chr10:62462549   R G chr1:210095648
RHOBTB1 (3')   F CCGCGGGAGCTTCCA   LPGAT1 (3') F GATTGCATGCCCTAATTATGGAA  
   R CCATTTTCATAACTTAGTCAAGAATGCT BC093035   R CCCTGAGAGATCACCGAGAAAG BC034621
LRRK2 (5')   F GGTACACAAAAGCAGAAAGAGATACAA chr7:133929455 RNGTT (5') F GCCACGGAGCTTCTTCCA BC019954
   R TTTGCACTTCATGTGGAAGATTG    R CAAAAGTTTTCCTAATGCCTACAACA  
pro chr12q12   F GGGAGCAGATGAGGAGCAAA chr12:39072588 pse chr6q15 F CATCTCCTTGGTGACAGGGTTT chr6:89180050
   R GGTGGACCTGGAAAATGGAA chr12:39072637   R TGGTCACTTGATTTATAAGAAACGTGTT chr6:89180152
CR749517 (3')   F TTTGACTTACTCGTTCACTGTGATCA   CNR1 (3') F CCACATAGGACTGGTTTTCAATTG  
   R TGTGGCTGCTGTGCTGAAA CR749517   R ATGCCTCCACCAGTGATTGC AK313908
        GGCCATCTAGGATCGACTTCAT  
  1. Target, primer sequences and position of sequences used for assay design. The same orientation of HERV-W element or solitary LTR and genes harboring such elements is indicated by sense, whereas opposite orientation is indicated by anti-sense. For simplicity, intergenic HERV-W elements transcribed in the same orientation as their adjacent genes were selected. Genes located upstream and downstream of intergenic elements are labeled 5' and 3', respectively.