Skip to main content

Table 3 Primers for qRT-PCR

From: Understanding Streptococcus suis serotype 2 infection in pigs through a transcriptional approach

Gene name Primer sequence (5'→ 3') GenBank ID
CD163 Forward: TCAGACACTATCCCCGTGCA Reverse: GGCGAAGTTGACCACTCCC NM_213976
ICAM-1 Forward: ACCCACACCTTGCTACCCCT Reverse: GTGGACCGTAGCCTCTGAGG NM_213816
TLR2 Forward: CCATCTTCGTGCTTTCCGAG Reverse: GGCGGTGTCATCGTTCTCAT NM_213761
TTR Forward: TCGCTGGACTGGTGTTTGTG Reverse: GGACTGCCTCGGACAGCAT NM_214212
VEGFA Forward: GAGACCAGAAACCCCACGAA Reverse: GGCAGTAGCTGCGCTGGTA NM_214084
GAPDHa Forward: ACATGGCCTCCAAGGAGTAAGA Reverse: GATCGAGTTGGGGCTGTGACT AF017079
  1. aGAPDH was used as a endogenous control.