Skip to main content

Table 1 Novel miRNAs identified in rESCs

From: MicroRNA profiling of rhesus macaque embryonic stem cells

Mature miRNA sequence MiRNA precursor location Name Reads
    IVF1.2 IVF3.2 IVF3.3
TATGGAGGTCTCTGTCTGGCT chr1:205,580,537-205,580,616:- miR-1843-5p 124 159 152
TCTGATCGTTCCCCTCCATACA chr1:205,580,537-205,580,616:- miR-1843-3p 127 174 193
TGATGGGTGAATTTGTAGAAGG chr1:70,976,129-70,976,208:- miR-1262-3p 2,557 2,267 2,150
GTTGGGACAAGAGAACGGTCTT chr1:158,332,926-158,333,000:- miR-3122-5p 252 371 214
AATTCCCTTATGGATAATCTGG chr2:80519804-80519882:+ miR-3938-3p 138 227 104
CATGCTAGAACAGAAAGAATGGG chr3:106,443,245-106,443,327:+ miR-3146-3p 37 120 61
TATTTTGAGTGTTTGGAATTGA chr4:125,407,861-125,407,939:+ miR-3145-3p 35 36 31
GAAAATGATGAGTAGTGACTGATG chr4:128869861-128869951:+ miR-3622-3p 72 243 73
AAGAGCTTTTGGGAATTCAGGTAG chr5:144,708,317-144,708,405:- miR-3140-3p 151 358 200
ATATACAGGGGGAGACTCTTAT chr7:164,327,476-164,327,555:+
chr7:164,328,696-164,328,775:+
miR-1185-3p 52 176 105
CGGGAACGTCGAGACTGGAGC chr7:164,844,819-164,844,896:- miR-1247-3p 127 131 32
TTAGGGCCCTGGCTCCATCTCC chr9:73,887,081-73,887,164:+ miR-1296-5p 33 123 53
TCGACCGGACCTCGACCGGCTCG chr9:103,084,702-103,084,783:- miR-1307-5p 291 872 944
ACTCGGCGTGGCGTCGGTCGTGG chr9:103,084,702-103,084,783:- miR-1307-3p 1,936 3,975 3,030
GACTCTAGCTGCCAAAGGCGCT chr11:98,713,141-98,713,223:+ miR-1251-5p 40 97 59
TGTGGGACCTCTGGCCTTGGC chr11:105706113-105706195:+ miR-3922-3p 192 250 248
TGCGGGGCTAGGGCTAACAGCA chr16:11,829,804-11,829,901:+ miR-744-5p 11,447 24,797 14,171
CTGTTGCCACTAACCTCAACC chr16:11,829,804-11,829,901:+ miR-744-3p 75 81 104
TTTCCGGCTCGCGTGGGTGTGT chr16:18,891,345-18,891,423:- miR-1180-3p 30 133 77
CCGTCCTAAGGTTGTTGAGTT chrX:68,990,098-68,990,174:+ miR-676-3p 46 206 206
TTCATTCGGCTGTCCAGATGTA chrX:113,236,410-113,236,505:+ miR-1298-5p 246 893 852
CATCTGGGCAACTGACTGAACT chrX:113,236,410-113,236,505:+ miR-1298-3p 30 98 58
TGAGTACCGCCATGTCTGTTGGG chrX:113,271,154-113,271,232:+ miR-1911-5p 88 843 473