Skip to main content

Table 4 Primers used to amplify 10 candidate genes by qRT-PCR

From: Identification of genes differentially expressed in a resistant reaction to Mycosphaerella pinodes in pea using microarray technology

Gene Forward primer (5'-3') Reverse primer (5'-3') Reference accession
Peroxidase (PsOXII) cttggaggacccacatggat tttggcttgctgttcttgca GenBank:AB193816.1
Disease resistance response protein 39 (DRR230-b) gggagtatgcttcacgaatgc ttttgagtgcagaaacatttcca GenBank: LO1579.1
12-oxophytodienoic acid 10,10-reductase (OPR1) aagtgaatgacagaaccgatga atggaaaccgacagcgatt GenBank: AY954368.1
Glutathione S-transferase gttcgtcctcctccgctaact gttcgtcctcctccgctaact GenBank: AB087837
Nine-cis-epoxycarotenoid dioxygenase 4 (nced4) ctctcttcccgaacgtcttctc cgcacgtggatccataaccgcc GenBank: U69554.1
6a-hydroxymaackiain methyltransferase (hmm6) tttgaactttgttggtggagatatg aatcatgcagaacccacttgagt GenBank: U69554.1
Ferrodoxin NADP oxidoreductase acaagcaagtgtgccgaaagt ggaggttcagaaaggattttcca GenBank: X99419.1
Chlorophyll a/b-binding protein gttttcgcatcaacggactt attgcccaccagggtaaag GenBank: EF488077.1
GA protein tgcagacagctttaacctttgc tgcgagacactctttggtgttg GenBank: X65154.1
Ribulose 1 5-bisphosphate carboxylase small subunit caagtcttgaaggagcttgatgaa gttgtcgaaaccgatgatacga GenBank: J01257.1