Skip to main content

Table 3 Details of the primers used for PCR amplification (A) Copy number and Relative expression studies by Real time PCR (B) in buffalo Bubalus bubalis

From: RsaI repetitive DNA in Buffalo Bubalus bubalis representing retrotransposons, conserved in bovids, are part of the functional genes

S.No. Primer/Sequence ID Forward Reverse Amplicon size (bp) Annealing Temp (°C) Nucleotide position of the primers in the sequence
   (A) PCR Primers     
1. pDp1 TGCACTCAATATGCCAGAAAA TGAAAGCAGTCTGTTGTTCCA 475 60 842-862
1296-1316
2. pDp2 TGCAGCAATCACAATCCTTG AACATCCTGGTTGCTTCCAA 124 60 66-85
170-189
3. pDp3 TTGCACAGAATGAGCAGTGGT GGCATTAATACTGGGATCAGG 101 60 492-512
572-592
4. pDp4 GGACAGAAATGGTATGGACCT TATATTGGAGAAGGCGATGGC 108 60 95-115
182-202
5. BBACOT11 (a) GAGCCGGCTGTCAGAGTC AGCCAGACAACCTGGAATGT 2504 60 34-51
2518-2537
6. BBACOT11 (b) TGAAGCTGAAGCCAACTGTG TCCTAAAAAGATCTTCATGACCA 2018 60 575-592
2570-2592
7. BBACOT11g AGTGAGGGGGTGTGCCCTGG TGGTCGCACCCTCCTCGGAG 601 60 1-20
582-601
8. β-Actin CAGATCATGTTCGAGACCTTCAA GATGATCTTGATCTTCATTGTGCTG 630 60 390-412
995-1019
9. CD45 GACATCGCAGTGTTTGTTGC GGAGGTTCACATTCCTCTCG 239 60 46-65
265-284
10 CDH1 TCTACAGCATCACTGGCCAACGAGCTG TGCTTGGACCATCAGGGTGTATGTGGG 476 60 566-592
1015-1041
   (B) Real Time PCR Primers     
11. Dp1 CCTGATGTTCAAGCTGGTTTTAGA CAGAGGATGTTGGCAATTTGATC 65 60 1042-1065
1084-1106
12. Dp2 GCAGCAATCACAATCCTTGGA TGTAGGTTTCTGTGTGGGCATAA 63 60 67-87
107-129
13. Dp3 CAAAGCAGTGCACAAGAATCAAT TGCCTTGCCCAACCTTTTTA 63 60 318-340
361-380
14. Dp4 AAGACCAGGGATCTCTTCAAGAAA CGAGCTCATCTTTGCATGAAAT 66 60 24-47
68-89
15. GAPDH GCAAGTTCCACGGCACAGT GATGGTGATGGCCTTTCCAT 68 60 227-245
275-294