Skip to main content

Table 2 New miRNAs and new members of known miRNA families with miRNA*s in M. truncatula

From: Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing

miRNAs Sequence (5'-3') Length (nt) Counts of miRNAs/miRNA*s Location Arm Length of precursors (nt) MFE (kcal/mol)
miR5213 uacgugugucuucaccucugaa 22 15045/44 MtChr2:16737666:16737796:+ 5' 131 -43.1
miR5274b auaugacggaguguaaaugcc 21 29/2 MtChr4:11424365:11424459:- 5' 95 -66.3
miR5554a ugugcaucuugaacaaugguau 22 134/3 MtChr1:31285750:31285854:- 5' 105 -52.8
miR5554b ugugcaucuugaacaaugguau 22 134/3 MtChr4:41013393:41013497:- 5' 105 -57.3
miR5554c ugugcaucuugaacaaugguau 22 134/1 MtChr7:19742691:19742795:- 5' 105 -53.3
miR5555 uaagaguauaauaugacuuug 21 40664 MtChr1:12905862:12905956:- 5' 95 -47.5
miR5556 ugaugacggaagaaauccaaa 21 155/1 MtChr4:23199944:23200064:- 3' 121 -54.8
miR5557 ugcuuccuuaguacuuguuga 21 5/3 MtChr5:6026167:6026481:+ 3' 315 -96.7
miR5558 uuuuccaauucuaagucuauc 21 139/8 MtChr5:20521087:20521172:+ 5' 86 -33
miR5559 uacuuggugaauuguuggauc 21 2124/2 MtChr6:937306:937443:+ 5' 138 -48.8
miR5560 ugccggcucaaugaaugcggag 22 62/2 MtChr6:4747428:4747538:+ 3' 111 -53.8
miR5561 cauuuggagagacauagacaa 21 449/3 MtChr7:30170572:30170660:- 5' 89 -42.9
miR5562 uguggagucuuuugcaugaag 21 16/1 MtChr7:32194444:32194667:- 5' 224 -56.4
miR5563 ugauaucaggcaacucggucc 21 12/1 MtChr8:32699524:32699624:- 5' 101 -52.9
miR156j uugacagaagagggugagcaca 22 10341/23 MtChr1:3228429:3228554:+ 5' 126 -44.4
miR167b ugaagcugccagcaugaucug 21 40937/1 MtChr7:34009590:34009796:+ 5' 207 -78.7
miR168c ucgcuuggugcaggucgggaa 21 56024/1434 MtChr5:10397699:10397824:+ 5' 126 -68.8
miR172b agaaucuugaugaugcugcau 21 35344/63 AC235487:197944:198077:+ 3' 134 -55.5
miR172c agaaucuugaugaugcugcau 21 35386/8 AC233663:10168:10308:+ 3' 141 -52.8
miR408 augcacugccucuucccuggc 21 75/55 MtChr1:21952074:21952198:+ 3' 125 -45.1
miR2111u uaaucugcauccugagguuua 21 413/23 MtChr7:14331003:14331117:- 5' 115 -50.2
miR2111v uaaucugcauccugagguuua 21 1192/41 MtChr7:14356392:14356499:- 5' 108 -48.4
miR2592a gaaaaacaugaaugucgagcg 21 28/1 MtChr1:27380857:27381050:+ 3' 194 -89.4
miR2592bl uggcaaguuugaauuuaccuca 22 43/1 MtChr4:18239825:18239954:+ 5' 130 -69.3
miR2592bm ggaaaacaugaaugucgggug 21 918/294 MtChr5:3041012:3041204:+ 3' 193 -104.4
miR2592bn ggaaaacaugaaugucgggug 21 530/160 MtChr5:8400182:8400375:+ 3' 194 -111.8
miR2619b auauguuuugauucuuuggca 21 9/3 MtChr4:6335670:6335840:+ 5' 171 -94.7
miR2643b uuugggaucagaaauuagaga 21 361/11 MtChr5:41836449:41836558:- 3' 110 -38.8
miR4414a agcugcugacucguugguuca 21 663/45 MtChr1:30518803:30518924:+ 5' 122 -50.5