Skip to main content

Table 3 Potential novel melon specific miRNAs

From: Analysis of the melon (Cucumis melo) small RNAome by high-throughput pyrosequencing

Melon sRNA namea nt sRNA sequence Number of sequences Hits in genome miRanda scoreb Potential precursor lenght (nt) MFEIc
a34_130677_ 21 AUAGAUAUUGAUAUGCUUUUA 1 4 163 94 -1.0573
a24_2602_ 21 UGCUACAUGGUUUAUCAGUGA 2 5 115 72 -1.2524
a24_177791_ 21 UCGCAGAAGAGAUGGCGCCGA 7 1 143 91 -0.8587
a23_118111_ 21 CAUUGAUAGACACUAAUAGAA 1 5 167 90 -1.475
a33_14294_ 21 AUAGACUUCUAUUGGUGUCUA 1 1 154 74 -1.5105
a32_31625_ 21 GUUCCCACGGUAAUGAUAAUA 2 1 127 72 -1.1045
a32_1324_ 21 AGGUGUCAUCUUGCUGCGAUA 1 1 179 99 -1.2
a22_190223_ 21 UGUUAUGCAUGGCGUCGGGAG 1 5 187 157 -1.2915
a14_98657_ 21 AUAGCGAAGUAUAUCAGUGAU 1 1 154 127 -1.2423
a14_51701_ 21 UGAGCCGUGCCAAUAUCGACG 1 1 159 97 -1.1
a14_180374_ 21 UAAAUAUUUAGAAAGUCAAUC 1 4 159 79 -1.855
a21_80766_f 21 UAAUAUUCAUUUUCACUUCUU 1 1 116 232 -1.2494
a21_78863_ 21 UGCAUCCUGAGGUUUAGGGAG 3 1 159 194 -0.9776
a21_244426_ 21 AGUAACCACUAAGCUAAUGGC 1 1 187 597 -1.0096
a23_1441_f 21 UAUAGCAAAGUCUAUCGAUGG 5d 1 107 77 -1.1435
a13_84447_e 21 GGUCAUUCUAGCAGCUUCAAU 13d 1 139 201 -0.96
a23_370_e 21 UGGUGUGCAUGUGAUGGAAUA 13d 1 163 113 -0.9061
a21_134553_f 21 GUUAUACGAGUUGGGUUGGGU 1 1 155 114 -0.9571
a11_95657_ e 21 UUGUGUCAUUGACAUUGUGGU 1 2 195 191 -1.1708
a14_9427_ 21 UCGUCCUGAGAAUACAUGUCA 35d 1 159 97 -0.9409
a14_668_ 21 UGAGUUAUCGGUGAAUUCAAG 5d 3 159 516 -0.9675
a13_252112_ 21 ACUGCUGCUUGUACUAUUGAA 1 1 191 255 -1.9670
a11_33177_ 21 UUUAGUUUAGCCUAUUGCUUU 1 3 187 139 -1.1035
a11_191362_e 21 UUCUAUUGUCUUCAUUUGUGA 1 1 191 119 -1.2718
a34_224062_ 21 UGAAAUGACUUGUCAAGUGCU 1 1 151 97 -0.975
a13_228150_ 21 CUUGUACUUGAUUUUGUUGCC 1 1 191 115 -1.4469
a12_32299_e 21 AAUUUGUUGGUCAAAUGAUUG 2 1 195 107 -1.7552
a12_272161_ 21 UUGUAUGGUGGAAAGAUGGAA 1 1 162 96 -1.4167
a11_33986_ 21 GCUGACUUGCUGAUUGAGUUA 2 3 179 189 -1.4852
a13_33760_ 21 UGAAUUAUCUGCUUAAGUUUU 1 1 187 95 -1.2889
a11_389198_ 21 ACACGCAGAAGAGACGAUUGA 1 1 191 120 -1.5575
a13_357842_ 21 UGGAGCAAUAUUGAUGCAUAU 1 1 195 220 -0.9548
a11_364692_ 21 UUGGGUCUAUUUAAUGGGAGC 1 1 155 107 -1.2308
a13_281334_ 21 ACUUUCUGUCAAUAUAAUCAG 1 1 175 115 -1.3943
a12_71107_ 21 UAUCAUAGUUGGUGGUUCAGG 3 1 143 115 -1.2167
a13_120551_ 21 UCAACGAUAGACAUUGAUAGA 1 1 171 107 -1.2875
a12_123886_ 21 UUAUCAUUGAUAGACUAGUAU 1 2 155 174 -1.0612
a11_227522_ 21 CAAGCCCAUGACAAAGCAAGC 1 1 187 225 -1.0929
a14_133932_f 21 UCAACACGAUCGUCUAGCAUG 1 2 173 113 -1.2295
a11_203340_ 21 UUUGAGUGUCCUACUCACCUC 1 1 191 411 -1.0833
a11_11135_ 21 UAGUGCCGCGCUGCGUGCGUC 85 1 147 102 -0.98
a11_31022_ 21 UUUCGCUUUUCCUCUUUCGUG 1 1 191 454 -1.1523
a12_144938_ 21 UCGUGGAUAUUGCUCUUUUCU 2 1 171 504 -1.3303
a33_181157_ 22 GAUAGAUACUAAUAUGCUUCUA 1 2 188 87 -1.3227
a33_37151_ 22 AGAUUAAUUUAUUGGGCGUUAU 1 2 144 94 -1.3313
a12_72169_ 22 UUGAGCUAUGCUCAGGUUGACA 30 1 176 174 -1.2933
a24_96796_e 22 UGAGCUAUGCUCGCUUUGGCAA 21d 1 175 169 -1.2855
a11_378153_ 22 GAGUUCCUAAGUUUUGAUGAAU 1 1 144 351 -1.2221
a11_378297_ 22 UUUUGGAUUCUAUCGAUGAAAG 1 1 155 123 -1.4857
a23_244052_e 22 GGGCAGCCCCACGUUGGGCAUG 5d 1 175 353 -0.9263
a11_85662_ 22 AAAUAUAUCGGUGUCUAUCAAU 1 2 132 85 -1.2208
a21_388555_ 22 GAUAGACGCUGAUAGAUAGACA 3 1 124 76 -0.8963
a11_84237_ 22 CGGCCAAAAAUGACUUGCCCGG 2 1 150 105 -0.8902
a23_124460_ 22 AGGUGAGUUCUUUUUAUAGGCU 1 1 184 179 -1.6306
a23_163065_ 22 AUUUGAUUAGCCAAAUUUAAAC 2 2 148 130 -1.0514
a23_71826_ 22 CAAUAGUCAGAUGUAAACGAUC 1 1 180 228 -1.4282
a22_52587_ 22 AAAAUUAUUGGGUGAAUUAGUU 2 1 179 162 -0.9013
a13_234225_ 22 UGAAUUUUGUUAUGUUUUGUAA 1 2 168 80 -2.0417
a13_286453_ 22 AGUCUAUCACCGAUAGAAGCCU 1 6 182 430 -1.4372
a21_339397_ 22 CGCGAGGUUCUUUGUUUGUCUU 1 1 192 413 -1.3341
a14_283014_ 22 UACCUAGUGAUGCCAUUGUCAA 1 1 184 533 -1.2829
a21_170878_ 22 CUAAGGUUGCCCAGAGAUGUUC 1 1 163 271 -1.2341
a21_63125_f 22 GAAUAAUUAUCAAGUGUGUAGC 1 1 165 210 -1.7804
a11_146182_ 24 UUAAAAUGUUGCUAUAUAAUUAAU 1 6 202 390 -1.6207
a21_169735_ 24 UAUACGGGCCGUAAAUAGUUUGAU 2 6 132 369 -0.8885
a23_3672_ 24 UUGCUCAUUGCUAACUGCAAAGAG 1 3 198 183 -1.7594
a14_260703_f 24 UUAAAAGUAUGAGACGAAAAUGAA 1 1 190 111 -1.4204
a14_218837_ 24 UUAAAAAGAACUACACGAACGUGC 1 1 194 342 -1.1314
a14_148530_f 24 AAAUAGCGUCGGGGAAAGGUGUCU 3 1 152 73 -1.0167
a21_127379_ 24 UGGGACAAAAGAAAACUGUGGGUC 2 1 162 586 -1.32
a11_2899_ 24 AUGAUGCUUUGGUGCUAAGGAGGU 1 1 198 470 -1.6094
a11_248538_ 24 AUUUUUGGCAUUUUACACGGUGAG 2 2 192 218 -1.5206
a13_59670_ 24 AGUGGAGUGGGCUAUUUUAGUCCA 6 1 166 570 -1.1249
a32_72333_ 24 AACUAUUUUAUUGGAACAUGUUGA 3 1 170 96 -1.0391
a33_22103_ 24 AGUAUGAUCUCGGGCUAAGGUUGC 1 4 202 246 -1.4138
a24_224684_ 24 AACAAAACGAAUGAUCAAAAUGGU 3 1 134 80 -0.8871
a13_225824_ 24 ACCAAAUGGAUCUAUUCUUAUAAU 1 1 198 311 -1.3393
a24_82972_ 24 AACGAUCGGGUUGACUACGUAAAU 3 1 190 146 -0.9354
a21_98074_ 24 AAUUUUUAGUGGUCCCGAAAUGCA 3 1 166 112 -0.9033
a11_350684_ 24 UGAGUGUAUCAUCGAGAUAGUGCG 1 1 190 307 -1.1642
a21_216237_ 24 AAAUUUCAGGGUCUAAAUUGAUGC 2 1 138 447 -1.2096
a33_49599_ 24 CAGCGUGAUUGAUGGGGCAUUUUU 3 1 118 287 -1.4678
a33_58155_ 24 AUGGUCGAUCUCAACCGAGAUUGA 1 1 194 298 -1.3188
a23_103110_ 24 CGUGAAGAUUGUGGAUAUUGGAGA 1 1 190 414 -1.5507
  1. a Precursor secondary structures of sRNAs in bold are represented in Figure 4.
  2. b miRanda score calculated for the identification of the complementary region to the putative miRNA.
  3. c MFEI index calculated as described [35].
  4. d Include cases where sequence variants with up to two mismatches were identified and counted
  5. e Indicates miRNAs for which a miRNA* sequence was identified.
  6. f Indicates miRNAs for which an asymmetric bulge of more than 2 bases was identified in the miRNA/miRNA* duplex of the precursor, not meeting exactly the structural criteria previously set forth [36, 37].