Skip to main content

Advertisement

Table 7 Probes used for the RT-qPCR measurements

From: Transcriptional responses to glucose in Saccharomyces cerevisiae strains lacking a functional protein kinase A

Gene Direct oligonucleotide Reverse oligonucleotide Product(bp)
PDC1 TAGAACTCCAGCTAACGCTGCTGT (1053-1076) TGGGAAAGTGGTTTGGTTGATACC (1180-1203) 151
PDC5 GCCAAGTCAACTGTAACACCGTCT (44-68) CAGCATAGGCAGCGTTCAATTCGT (149-173) 130
HXT6 GGGCTGTTTGGTCTTCATGTTCTTC (1497-1521) CATTTCTTCAGCGTCGTAGTTGGC (1642-1665) 169
ALD5 AGCCAACAGTGTTTGCTGATGTCAA (1205-1229) GCGGCTAACCCATATTGAGAATCAT (1322-1346) 142
TPS1 TCTCGTCCACCCGTGATGGTATGAA (1301-1325) ATGGCATCAGAAAGATCATCGGTGT (1160-1164) 166
TPS2 GGGCAACTACGGATTCTATCCTGTC (2430-2454) TCTGGAATCCAGGTCGACCGTACCA(2568-2592) 163
ATR1 TTATTAGTAGAGCCTTCCAAGGGC (494-517) CAACCTAAAGTTCGTCCAATAGGG (601-647) 156
GRX2 CTACTCCAAAAATGGTATCCCAGG (92-115) GGAACGTTCAATTCTTGGAAGAGG (210-233) 144
PEP4 GATAAGGTGGTCCCTCCATTTTAC (622-645) AACAGGTAACCAAGTGATATCGCC (769-792) 173
TMT1 TGATTGAAGTTCCTTACGGGAAGC (494-517) CTTTGTCTCTCACATCTTCTGCAC (629-652) 161
YMC2 GTTGACAGTATACCCATTGGACGTT (762-786) CCAAACCCTTTGAAAAAGGCTCTGA (881-905) 146
  1. The oligonucleotides were checked for specificity using the BLAST feature of SGD.