Skip to main content

Table 5 Characterization of 40 EST-SSRs among 24 sesame accessions

From: Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired-end sequencing and development of EST-SSR markers

Primer SSRs Forward primer (5'-3') Reverse primer (5'-3') No. of alleles Ho He PIC
ZM_1 (CA)6 GTTTCTTGGTCTTATCACAGC TACCAACGTCACTCTTCTTTC 5 1.00 0.72 0.66
ZM_2 (AC)8 CTTCTTGAAGTTCTGGTGTTG ATTCTTGGAGAAAGAGTGAGG 6 0.91 0.77 0.72
ZM_3 (GT)8 ATCACCACACACTGACACAG CGTGTCTGAGAATCCAATATC 7 0.96 0.79 0.74
ZM_4 (AC)8 TCCAGAGAGGAGACAATAAGA GAGATAGATTGCGAGTTGTGT 4 0.71 0.72 0.64
ZM_5 (CT)10 GATAAAGAACTGCCAAGGAAC CACAGCAGTGAAGAAAAGAGT 6 0.71 0.74 0.68
ZM_6 (GT)9 GGTGTGTTCTCTCTCTCACAC GGGCTGCTCAATAAATGTAG 6 0.75 0.78 0.73
ZM_7 (AGC)6 ATCCTCTGCTCCTAACTTCAT TCTGGTACTATCCTCAAGCAA 6 0.96 0.79 0.74
ZM_8 (AG)6 TCTCTCTCTCTCTCGTTCTTG CCCACTGTACCTCTCCATATT 5 0.70 0.73 0.66
ZM_9 (AAT)5 CTCGCCGTTCTAACATTATC AGTACAGTCTCCTCCGATTTT 5 0.50 0.72 0.65
ZM_10 (CTTCCT)4 ATGCCCATCTCCATATACTCT AATTCTTGCCTGACTCTACG 8 0.83 0.81 0.76
ZM_11 (CT)12 GGATTCTCTAGACATGGCTTT AACGCAGAATTCTCTCCTACT 8 1.00 0.85 0.81
ZM_12 (CT)7 ATTGCTGTGCAATCCTTATC ATCTCTTTCTACCACCACGTT 5 1.00 0.79 0.74
ZM_13 (GA)7 GCAGAAGGCAATAAAGTCAT GCGTCAGAAGAAAAATACTGG 7 1.00 0.80 0.75
ZM_14 (ATC)5 GGAAGGCGAGTTGATAGATAA CATGGGATGTTCAAAGAACT 6 0.96 0.79 0.73
ZM_15 (GA)7 ACTCTATCACCGAGTGGAGAC CTACCCTTTTCCTCGTAGC 7 0.65 0.75 0.69
ZM_16 (GATC)4 AGGTAGAATTACATGCTGTGC GCTTCCTCCTTCATTCATATC 5 0.60 0.71 0.65
ZM_17 (CT)6 CTTGCTTCCTCTTTTCTCTCT ACACTGTACTCAGCGGATTT 5 1.00 0.79 0.72
ZM_18 (CT)6 AATACCCTTCAGTATTCAGGTG CAACAACACAAACACTGCTAC 5 1.00 0.80 0.75
ZM_20 (GAG)5 GGGATGTTGATAGAGATGTTG TCTTTCACTCTCACACACACA 10 1.00 0.86 0.82
ZM_21 (AC)7 CTCTCTCTCTCTGCTGTTTCA GCCATACGATCTCAAAATCAC 8 0.95 0.86 0.82
ZM_22 (AT)9(GA)6 ACCACCGATCTACTCACTTTT CCACTGCACACTACAGTTTTT 9 0.68 0.86 0.82
ZM_23 (AT)7(GA)8 CGTATGTCAAGATGAAGCAGT ATCAACAATTCCACTCAACC 6 0.95 0.75 0.69
ZM_24 (TC)6(CCATTT)4 CCACACTCAAAACCAAGAAA GCGAAGAGATTATATACACACG 5 0.75 0.72 0.66
ZM_25 (AT)6 CCTGAACCTTCTCTCTCTCTC ACTGACAGTACGAATTCACCA 4 0.58 0.71 0.64
ZM_26 (GA)8 ACTTCAACTTCAACCTCAACC TGTGCATAAAAACCCTCTCT 5 1.00 0.65 0.57
ZM_29 (AG)9 CATTACAATAGCCCGAAAAG TACTGTTCCTCCTCCTCTCTT 6 1.00 0.70 0.62
ZM_30 (TAT)5 CACTCCACTCATTATCCAAAG CAAGACACAACTGACACGTAA 6 1.00 0.77 0.72
ZM_31 (GA)7 GAGCACTCTCTTCTCTCTTCC AAAAGAGGATGGCAACTGTA 5 0.78 0.72 0.65
ZM_32 (GCC)5 CACGAAGAGTGAGAGAGAGAG CTACCAAAAGTCCCTGAATCT 5 0.77 0.70 0.62
ZM_33 (TCA)5 GAGACAGTACACTTGGGACAA CTCTTCTTGGGCATTAACTCT 6 0.74 0.73 0.67
ZM_34 (AG)14 AAGTCCCTTTTCAAGCAATC GAGAGAGGAAAATGCAGAGAG 10 0.79 0.83 0.79
ZM_35 (TTCC)4 AATGCATAGTGCATAGGGTAG TGGAAAGTAGAGATCGCATAG 6 0.96 0.75 0.69
ZM_38 (GA)8 CAGCTTCCTGATTTGATTTG AGATTGCAAGAATCGCTTAG 5 0.85 0.69 0.62
ZM_39 (TCA)5 AGAGGCAGAGGAGTTGATAAT CTTAACTGTAACTCCCTTTTCG 6 0.81 0.78 0.72
ZM_40 (ACTCCA)5 CGAAAAGGGAGTTACAGTTAAG CTTCCTCTCCTATCATCCTGT 7 0.82 0.82 0.77
ZM_41 (AC)8 GATATGATTCAAACCCCTCAG CTTCTGCACTACCATCAATTC 5 0.63 0.55 0.46
ZM_43 (ACAT)4 CTTGGATATCAGTTTCCTGTG GTTCTCCACAGTCAAAACACT 7 0.89 0.72 0.65
ZM_44 (TC)9 GTCTTAAGCCCTCTTAGTTCC GAAAACCTTCAATGTCAGGA 7 0.77 0.77 0.73
ZM_45 (TA)6 GCAAAATCTCTGTTGTCTCAG GTGTTCCTACCACTCAACACA 18 0.83 0.83 0.80
ZM_47 (TC)8 GTTTCCAGGTCTATTCCTTTG AGGTAGAGCTAATCCTTACCG 10 0.71 0.83 0.79
Mean     6.55 0.84 0.76 0.70