Skip to main content


Table 10 List of primers used for real time RT-PCR.

From: Skin healing and scale regeneration in fed and unfed sea bream, Sparus auratus

SAPD ID Gene Name Accession Number Primer sequence (5'→ 3') Amplicon (bp) Temp (°C) Efficiency
SAPD20351 Beta-2-glycoprotein I precursor IPI00298828 F: TGGTTCGCCTCCTGTCTCC R: GGTTCTGGTGACTCATCCTCTG 178 60 73.1%
SAPD01318 Collagen alpha1 I chain precursor P02452 F: AGACCTGCGTATCCCCAACTC R: GCCACCGTTCATAGCCTCTCC 110 57 83.4%
SAPD03530 Collagen alpha2 V chain precursor IPI00293881 F: ACCTGTGACGACCTGAAGAGATGC R: TGGATGGGTTGGCGGAGATGC 145 60 86.8%
SAPD00344 P22phox protein NP_001027717 F: ATGCTTGCCACCGTCCTG R: TCTTGATGCTCTCTGCGACTG 139 60 82.4%
SAPD02155 Proliferating cell nuclear antigen (pCNA) P12004 F: GAGCAGCTGGGTATTCCAGA R: CTGTGGCGGAGAACTTGACT 148 60 83.4%
SAPD13946 Retinol-binding protein I, cellular P82980 F: TCCGCACCATAACCACCTTCAAG R: CCAGCCTCGTCCTTCCTTCTCC 168 60 78.6%
--- Ribosomal protein S18 AM490061 F: AGGGTGTTGGCAGACGTTAC R: CTTCTGCCTGTTGAGGAACC 164 60 92.1%
  1. Microarray Probe ID, primer sequences, amplicon sizes, annealing temperature and qPCR efficiency are shown.