Skip to main content

Table 1 Sequences of primers used for qRT-PCR:

From: Gene expression profiling in the Cynomolgus macaque Macaca fascicularis shows variation within the normal birth range

PASK F 5' CTACTCCGGGAGCTGCTATC 3'
PASK R5' AGCAGCAGAACAGAGGTGTG 3'
116936 F5' GCACATCTGCCTGAAGTGAA 3'
116936 R5' GAGCAGCTTGTCCAGGAAGT 3'
ADK F5' TGGTGGCTCTACCCAGAACT 3'
ADK R5' CATCTACATGGGCTTCAGCA 3'
ELMO F5' AGCTCTGTGTGGCTTGGTTT 3'
ELMO R5' CGGTGTGAATAACGGAGTCCT 3'
SIX1 F5' GTTTAAGAACCGGAGGCAAA 3'
SIX1 R5' GGAGAGAGTTGGTTCTGCTTG 3'
SLC12A9 F5' GGCTTCAACAGCAGTACCCT 3'
SLC12A9 R5' AAGAGGACAGCAAAGACGCT 3'
RBL1 F5' TAGCCTGACCAACATGGAGA 3'
RBL1 R5' GTTCAAGCAATTCTGCCTCA 3'
Uni18SrRNA F5' AGTCCCTGCCCTTTGTACACA 3'
Uni18SrRNA R5' GATCCGAGGGCCTCACTAAAC 3'