Skip to main content

Table 3 List of primers used in qRT-PCR analysis

From: Screening and identification of seed-specific genes using digital differential display tools combined with microarray data from common wheat

Unigene Forward primers (5'-3') Reverse primers (5'-3')
Ta.23798 GACCGTTCACAACACCC TATTTAGCAGATAGCACCAC
Ta.63039 CGAACGCCCTCATGTGTTT CATTGGTTGATGATTGGGATTG
Ta.19 GGAGCAGGTGCAAGTAGAGG CGTTTGGTTCATCGGAGC
Ta.4334 CTGTGCAGAATATAACATGGAGG CAAGGTCACATTCAGACTGGTTTC
Ta.10140 CCATTCCTCGCTAGGCTGA GTACTGGTTGTCGAACACGTTG
Ta.118 CAAGCGTTTGTGGAAGTGAAC CAAGGAAGAGGAAAGGGTGAT
Ta.35848 TCGGCTTCATTTACTGCGT ACTCCGTGACTGGCTTTGG
Ta.41965 GCAACATCGTAACTGCCAACA GCACCAAAACACACTGACAACA
Ta.54446 GGTGTACCCACTCTTCATCTTGG CGGCGAGGTTCCTTGACTAC
Ta.7721 GCTGCAACTTCTGCAACACA CCCCTCAAGTTCACCGACA
Ta.23679 ATACCACCCACAACCGAGATG CCACCCCTACAAATGACCG
Ta.54227 CAAATACGCCATCAGGGAGAACATC CGCTGCCGAAACCACGAGAC
Ta.2291 GCTCTCCAACAACATTGCCAAC GCTTCTGCCTGTCACATACGC
  1. Two transcripts (Ta.54227 and Ta.2291) were chosen as internal controls for data normalization.