Skip to main content

Table 1 Primers used for qRT-PCR

From: Development of a novel multiplex DNA microarray for Fusarium graminearum and analysis of azole fungicide responses

Gene IDa Forward primer (5'-3') Reverse primer (5'-3') Amplicon (bp)
CYP51    
FGSG_01000 TCTACACCGTTCTCACTACTCC GCTTCTCTTGAAGTAATCGC 170
FGSG_04092 CCCTTACACGATCACTACAGAC CTCTTCGTTCCTTTAGACACAG 186
FGSG_11024 ACTTGGTCTCACCACAGATTC CATAGATCGGACTTCGTTTC 187
ABC transporters    
FGSG_00046 CTACTATCTGGGTGAACCTGTG GCCACTGTTTTCAGGAGTATC 209
FGSG_02786 CTTCGGCAAGATATGAGCTTC GCGAGTATGGAACTCGATAGG 161
FGSG_03032 CCTCGCAAGACAACCATACAG AGAGTGATGTCGCGAATATCG 176
FGSG_03882 GAACTCACGTACTCTCCTCAAC TCGACATCAACTCTCTCTTGAC 168
FGSG_05076 GTGCTATGCTCCAGCAATACC CGATCAGAAGAGCGAACTGAG 198
FGSG_06771 TCGTCAGTCCAGAAGTCAAG TTCGGTTCACAAAGTAGTCC 180
FGSG_06881 AAACCCCGTTGAAACAGAAC ATCAAACCATAAGCGACGTTC 186
FGSG_07325 CCTCTATGCTTTCCTTCATC ATACCGTGTCTTCAACTGTCTC 207
FGSG_08308 ACAGGCTCGTCTATTCACAG GACCCCTTGATAACCTCTAAC 187
FGSG_08309 GTCTCTTTGTATCAGGCTTCC CATATTCTCTCTCCCACTCATC 199
FGSG_08312 GATCGTCCTCTTCACTATTACC CTCTCAGCAGTAACCATAGGAC 183
FGSG_08373 CTGTGACGATACCGAGCTGAC CCTGTATCGAGCCAAATCAAG 120
FGSG_08830 GACTACTTGGCTTCTCTTTCC CACCATCTTCTTGACTACCAAC 250
FGSG_10995 ATTTATGACCACGCAGTCTGG CTGCGAAAAGAGGTTCGTTAC 121
FGSG_11028 GACACACTACCGACACAACTG GACTGAGAAGACGAGAAGAAG 225
FGSG_11988 GATGTAATGCTACCTGGAACAC GATGAGACCGATTGTGAGAAC 195
Transcription factors    
FGSG_00069 GAATCTTCTCCGGCACTCAG TTCTTCACTTCCTTCCGAGATC 139
FGSG_01293 CCCGATATAGTCGAGCCTAAC GGTATTTGTTGCTCCGTTGAC 101
FGSG_01341 ATTCTGGCATGGATGATGAAG CACCAAAGTCACTGGCATATCC 162
FGSG_01669 TTCGACTTCTCACAGCTCAGC TGCCTGCATGTTGTACTGGTC 120
FGSG_05949 TTCGGCAACCATCACTCCTAG TGCTGTTCGTTCTCTCGCACT 100
FGSG_06324 ACAGAGTGTCGAACCAGCAAC GGTTCTCGTGGGATGCTATC 173
FGSG_06810 ATACCCGTCTCATGAACATCG TCGATAACAGCCTTGGCTATG 127
FGSG_09333 CACAGCTCAACGATGCAATG CAAGATAAGCAAGGATGCTGTG 101
FGSG_09349 GCTTGATTGCCCCTCTGAGA GGTTCGCATTCTCCTGGTTC 123
FGSG_10470 AGAGATCACCACGTCCGAAC TGGTGGGTGTAGATGTGGTTC 114
FGSG_10914 CATCGGGCTCTAGTACGAATC CCAGAAAGCAGCAGTATGCTC 141
FGSG_11561 ACTCGAAAGCATTGGATCAGC AGACGGACGAAATCATCGTC 130
  1. a The given gene ID is the entry number of the F. graminearum genome annotation FG3 provided by Broad Institute.