Skip to main content

Table 4 Primers used in real-time PCR amplification of bacteria and host gene.

From: Conjugating effects of symbionts and environmental factors on gene expression in deep-sea hydrothermal vent mussels

Gene Primer sequence 5'-3'
Sulfide oxidizer symbiont 16S Forward GAGTAACGCGTAGGAATCTGC
  Reverse CGAAGGTCCTCCACTTTACTCCATAGAG
Methanotrophic symbiont 16S Forward GTGCCAGCMGCCGCGGTAA
  Reverse GCTCCGCCACTAAGCCTATAAATAGACC
Cytosolic malate dehydrogenase (host) Forward ATGGAGGAAAGAGATATGGCACTGAGCGT
  Reverse TAACATTAAACATAGCCTAGGAACCTAATG
ATP sulfurylase (SOX) Forward GTGCGTGATGCCGCTATCCGCACCATG
  Reverse GGTCCGGCATAGAGCATGTCAAACGGATA
Particulate methane monooxygenase A (MOX) Forward GAGTGGATTAACAGATATTTGAACTTCTGG
  Reverse CATACCACCAACAACAGCTGTAAGTACAAA
Ribosomal protein L15 (host) Forward TATGGTAAACCTAAGACACAAGGAGT
  Reverse TGGAATGGATCAATCAAAATGATTTC